ID: 1171488451

View in Genome Browser
Species Human (GRCh38)
Location 20:25500246-25500268
Sequence CAGGCTTCCCAGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171488451_1171488460 27 Left 1171488451 20:25500246-25500268 CCTGCATCCCTCTGGGAAGCCTG 0: 1
1: 0
2: 3
3: 18
4: 294
Right 1171488460 20:25500296-25500318 AGGACCACATCTTCCCTCCCAGG 0: 1
1: 0
2: 3
3: 19
4: 198
1171488451_1171488457 7 Left 1171488451 20:25500246-25500268 CCTGCATCCCTCTGGGAAGCCTG 0: 1
1: 0
2: 3
3: 18
4: 294
Right 1171488457 20:25500276-25500298 AAGGAGCTGTGTCCCATGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171488451 Original CRISPR CAGGCTTCCCAGAGGGATGC AGG (reversed) Intronic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
900987934 1:6083814-6083836 CACGCTTCTCAGAGAGCTGCAGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902661215 1:17905348-17905370 CAGGCTTCACAGAGGTCTGTTGG - Intergenic
903035918 1:20492481-20492503 CAGGCTTCTCGGTGGGATCCTGG - Intergenic
904206966 1:28861770-28861792 CAGGCTCCCTAGAGGGAAGCAGG - Intronic
904783177 1:32965568-32965590 TAGGCTTCCTAGTGGGAGGCAGG + Intergenic
905031254 1:34885745-34885767 CTGGCTTCCCGGCGGGATGGGGG + Exonic
905863670 1:41365771-41365793 AAGGCTTCCCAGAGGAGTCCAGG - Intronic
906019264 1:42613162-42613184 GAGGCTGCCCCGAGGGCTGCTGG + Intronic
906035838 1:42749963-42749985 AAGGCTTCCCAGAGGGAAATGGG - Intronic
906212090 1:44017615-44017637 CAGGCTCCACGGAGGGGTGCGGG + Intronic
907021435 1:51070141-51070163 CAGGCCTCCCAGATGGTAGCAGG + Intergenic
907461707 1:54609209-54609231 GAGGCTTCCCACGGGGAGGCAGG - Exonic
907489586 1:54800556-54800578 CAGTCCTCCCAGAGGGAGGTAGG + Intronic
908540853 1:65120709-65120731 AAGACTTCCAAGAGGGATGCAGG + Intergenic
908784318 1:67720101-67720123 CAGGCTTCTCAGAGCTGTGCAGG - Intronic
909000829 1:70215739-70215761 CAGGGTTCCCAGTGGGTAGCGGG + Intronic
911191203 1:94950149-94950171 CTGGCTTCCCAGAAGAAAGCAGG + Intergenic
913245737 1:116868554-116868576 CTGGCTTCCCTGGGGGATGCAGG - Intergenic
914345431 1:146794673-146794695 CAGGCTTCCCAAAGGAGAGCAGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915520574 1:156440062-156440084 CAGGCTCCCGAGAAGAATGCAGG - Intergenic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
917530491 1:175830736-175830758 CATACTTCCCAGTGGGATGTAGG + Intergenic
920184424 1:204151534-204151556 CAGGGCTGCCAGGGGGATGCGGG - Intronic
924626218 1:245698408-245698430 CGGGCTTCCCAGCGGGCTTCTGG + Intronic
1064362533 10:14679002-14679024 CTGGCATCCCACAGGGGTGCTGG + Intronic
1066243228 10:33557922-33557944 TTGGCTTTCCGGAGGGATGCTGG - Intergenic
1066436109 10:35397897-35397919 GAGGATTCCCAGAGGAGTGCTGG + Intronic
1067551170 10:47237573-47237595 GAGGCTTCCCCGAGGGAACCTGG + Intergenic
1068958626 10:62844449-62844471 CAGGCCTCCGAGAGGTAGGCGGG - Intronic
1069695129 10:70380867-70380889 CAAGCTTCCCACTGGGAGGCAGG + Intronic
1070497955 10:77041679-77041701 CAGGCCTCCCTGAGGGAAGGAGG + Intronic
1073057646 10:100712607-100712629 CAGGCCCCCCAGAGGGGTTCAGG + Intergenic
1074377359 10:112951188-112951210 CCGCCTTCCCAGAGGGGTGGAGG - Exonic
1075221406 10:120588100-120588122 CAGACTTCCCATAGGCAGGCAGG - Intronic
1075572620 10:123556946-123556968 CAGCCCTCCCCGAGGCATGCTGG - Intergenic
1075658223 10:124175613-124175635 CAGGCCTCACAGAGGGACTCTGG - Intergenic
1075664337 10:124219929-124219951 CAGGCGTCCCAGAGGGGGACAGG - Intergenic
1075676914 10:124302147-124302169 TAGGCCTCCCAGAGGGTTGATGG - Intergenic
1075726402 10:124613016-124613038 CAGGCTCCCCAGTGGGAGACAGG + Intronic
1075743256 10:124708814-124708836 CTGGCTTCCTAGAGAGAGGCTGG - Intronic
1076329242 10:129652739-129652761 GAGGCCTCCCAGAGGCAGGCAGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076720181 10:132389034-132389056 CAGGCTTCCTTGAGGGAGCCAGG - Intergenic
1077234109 11:1471644-1471666 CAGGCTCCCCAGCGTGATCCTGG - Intronic
1081432423 11:42990619-42990641 CAGGCTTCTCAGATGGTTACCGG + Intergenic
1081537536 11:44006290-44006312 CAGGCTTCCTTGTGGGATGGAGG + Intergenic
1082941446 11:58709571-58709593 CAGGTTTCTCAGTGGGAAGCAGG - Exonic
1084452946 11:69250893-69250915 CATGCTTCTCTGTGGGATGCTGG + Intergenic
1084520584 11:69660192-69660214 CAGTCTTCCCTTAGGGCTGCAGG - Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1085250854 11:75142863-75142885 CAGGCCTCCCTGATGGATCCTGG - Intronic
1087132916 11:94684362-94684384 GAGGCTTCCCAGAGGTCTGCAGG + Intergenic
1087983754 11:104651135-104651157 CAGCTTTCCCAGAGTGATTCTGG + Intergenic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1091315329 11:134610349-134610371 CCGGCTTCCCTGAGGGCTGGAGG + Intergenic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1098323599 12:69277479-69277501 TAGGCCTCCCAGAGTGCTGCTGG - Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102705797 12:114879434-114879456 CTTGCTTGCCAGAGAGATGCAGG + Intergenic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1104718934 12:131033930-131033952 CAGTCCTCCCCGGGGGATGCCGG + Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1109830037 13:67773555-67773577 GAGGCTTCCCATAGGTTTGCAGG - Intergenic
1111848258 13:93539261-93539283 CATGCTTCTCAGTGGGATGTGGG + Intronic
1112130437 13:96517438-96517460 TAGGCTTCCCAGGGAGATGGGGG + Intronic
1112349758 13:98623006-98623028 CAGGCGGCCCAGAGGAATGGAGG + Intergenic
1113250634 13:108448781-108448803 CAGGCTACCCAGAGGGCTAAAGG + Intergenic
1114263333 14:21055564-21055586 CAGGCCTCCCTGAGTGAGGCTGG + Intronic
1114632435 14:24167825-24167847 TTGGCTTCCCAGTGGGATGATGG - Intergenic
1115296253 14:31830669-31830691 CAGTCTTCACAGAAGAATGCAGG + Intronic
1116824628 14:49660637-49660659 TCGGCCTCCCAGAGGGAGGCTGG - Intronic
1117047237 14:51825758-51825780 CTGGTTTCCCAAAGGGTTGCTGG + Intergenic
1117730368 14:58715960-58715982 CAGGCTTGGCAGAGGGTTTCAGG + Intergenic
1119879915 14:78091953-78091975 CAGACTTCCCAGAGAGGTTCTGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1122921467 14:104882128-104882150 CCGGCTTCTCAGAGGGAGTCAGG + Intronic
1123125832 14:105945357-105945379 GCGCCTTCCCAGAGGGCTGCTGG + Intergenic
1124061074 15:26294165-26294187 CATGCATGCCAGAGGGCTGCTGG + Intergenic
1124404136 15:29379277-29379299 CAGGCTTCACAGAGGGGCTCAGG - Intronic
1126309696 15:47301550-47301572 CAGGCTTCCCCCAGGGCAGCTGG - Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1129230104 15:74192340-74192362 CAGGCTTCCTCGAGGGGTGTTGG + Intronic
1129885482 15:79034103-79034125 GAGGCTTCCCAGGGGGAAGTAGG - Intronic
1129969913 15:79769179-79769201 CAGGCGGCCCTGAGGGATGGAGG - Intergenic
1130542233 15:84828492-84828514 CAGGCTCTCCAGAGGGAGCCTGG - Intronic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132586269 16:706882-706904 CAGGCTTCCCATCAGGACGCTGG - Intronic
1133027783 16:2996238-2996260 CAGGCTTCTTAGAGGGAAGGGGG + Intergenic
1133270235 16:4607784-4607806 CAGGCACCCCAGGCGGATGCAGG + Intergenic
1134093283 16:11402869-11402891 GAGGCCCCCGAGAGGGATGCAGG - Intronic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1135740569 16:24971853-24971875 CAGGCATCCCAGGGAGACGCAGG + Intronic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136009841 16:27356411-27356433 CAGTCTCCCCAGTAGGATGCCGG - Intronic
1136571450 16:31099803-31099825 CTGGCTTCCCAAAGTGCTGCTGG + Intergenic
1136580021 16:31145801-31145823 CTGGCTACCCAGAGGGCCGCAGG - Exonic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1138680205 16:58678570-58678592 GAGGATTCCCAGATGAATGCTGG + Intronic
1138823479 16:60289779-60289801 AGGTCTTCCCAGAGGGCTGCAGG - Intergenic
1138917499 16:61484599-61484621 CATGCTTTCCAGAGGGATTGTGG - Intergenic
1139380831 16:66529652-66529674 CTTGCTTCCCAGAGGAACGCTGG - Intronic
1140041425 16:71410833-71410855 CAGGCTTCCGACAGAGTTGCAGG - Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1142169860 16:88616023-88616045 CAGCCTCCCCAGAGGAAAGCGGG + Intronic
1143008547 17:3852912-3852934 AAGGCTTCCCAGAGGAAGGAAGG - Intergenic
1144042203 17:11422092-11422114 CTGGCTTCCCAGGTGGCTGCCGG - Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1147671927 17:42181233-42181255 AGGGCTGCCCAGAGGGGTGCGGG - Exonic
1147874909 17:43614253-43614275 CAGGCTTCCCACTGGAGTGCTGG - Intergenic
1148781428 17:50124138-50124160 CCGGTTTCCCAGCGGGATTCCGG - Intronic
1148862576 17:50612378-50612400 CCGGCTTCCCAGATGGAGGGAGG + Intronic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1149663959 17:58352701-58352723 CTTGCTTCCCACAGGAATGCTGG + Intronic
1151662149 17:75524950-75524972 CAGGCTTCCCGAAGGGAGGAGGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152880134 17:82809726-82809748 CAGGCTTCCCAGAGCCCTGGCGG + Exonic
1153445599 18:5169102-5169124 CATGCTTCCCTGAGGAATTCAGG - Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154489910 18:14913352-14913374 CAAGCTACCCAGAAGGAGGCTGG + Intergenic
1156481132 18:37437111-37437133 CAGGCTCCCCAGTGGGTGGCAGG + Intronic
1157590434 18:48833421-48833443 CATCTTTCCCAGAGGGCTGCAGG - Intronic
1159032257 18:63243558-63243580 CAGACTTCACAGTGGGATGCTGG - Intronic
1159886671 18:73914245-73914267 CAGGCTCCCCATGGGGAGGCAGG - Intergenic
1160155763 18:76432729-76432751 CAGGCTTCCTAGAGAGAGGTTGG - Intronic
1160272344 18:77398411-77398433 CTGGCTTCCAAGAGGGCCGCTGG + Intergenic
1163128608 19:15258069-15258091 CTGGCTTCCCAGCAGGATTCTGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165002893 19:32779487-32779509 CAGGATTCCCAAGGGGATCCTGG - Intronic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1166956905 19:46470931-46470953 CAGGCATCCCAGAGGACTGTGGG - Exonic
1167528646 19:50001204-50001226 CAGGTTCCCCAGAGGAAAGCAGG - Intronic
1168580819 19:57554347-57554369 CTGGCTCCTCATAGGGATGCTGG - Intronic
926108966 2:10170067-10170089 CAGGCTTTCCAGAGAGAAGGAGG + Intronic
927047823 2:19297761-19297783 CTGGCTTAACAGTGGGATGCTGG + Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928170410 2:28999549-28999571 CAGGCTTCCAGGTGGCATGCTGG + Intronic
929556003 2:42926025-42926047 CAGACCTCCCTGAGAGATGCAGG - Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
931464373 2:62473794-62473816 AAGGGATCACAGAGGGATGCTGG + Intergenic
932566694 2:72915611-72915633 CAAGGTTCCCACAGGGATGCGGG - Intergenic
933412127 2:81939939-81939961 CTGGCTCCCCAAAGGAATGCTGG - Intergenic
934737595 2:96697826-96697848 GAGGCTTCCCAGAGGAATCAAGG - Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
942249382 2:174034506-174034528 CCGGCATCCCAGAGGCATCCAGG - Intergenic
944103984 2:196059664-196059686 AAAGCTGCCCACAGGGATGCTGG - Intronic
944671227 2:201996070-201996092 CAGGCTCTCCCGAGGGAGGCAGG + Intergenic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
946461625 2:219873791-219873813 CAGTATTCCCAGAGTGATTCGGG - Intergenic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
1168807635 20:681885-681907 GAGCCTTCAGAGAGGGATGCAGG + Intergenic
1169014358 20:2279659-2279681 CAGCCTGCCCTGAGGGATTCTGG - Intergenic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172003173 20:31797557-31797579 CAGACTTCCCAGTGGGATGCTGG + Intronic
1172311840 20:33924442-33924464 CAGAACTCCCAGAGGGATACTGG + Intergenic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1173020579 20:39264667-39264689 CAGGCTTTTCTGTGGGATGCAGG - Intergenic
1174180082 20:48669047-48669069 CATCCTTCCCAGAGGGCTGCAGG - Intronic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1176013564 20:62914651-62914673 CAGGCTTGCCCCAGGGAGGCAGG + Intronic
1176048766 20:63105747-63105769 CAGGTCTCCCAGGGGGATGCAGG - Intergenic
1176097957 20:63352901-63352923 AAGGCTCCCCAGAGGGCGGCTGG - Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1176924446 21:14730664-14730686 GAGGTTTCCCAGAGGGCTCCTGG - Intergenic
1178883615 21:36467499-36467521 CAGGCTTCTTGGAGGGGTGCGGG + Intronic
1178883644 21:36467661-36467683 CAGGCTTCTTGGAGGGGTGCAGG + Intronic
1179052244 21:37897694-37897716 GAGACTTCCCTGATGGATGCAGG - Intronic
1179668866 21:42931490-42931512 CAGTCTCCCCAGAGGCTTGCAGG - Intergenic
1180824465 22:18853157-18853179 CAGGCTCCCCAGTGAGCTGCGGG + Intronic
1181150973 22:20883330-20883352 GAGGCTATCCAGAGGGATGAGGG - Intronic
1181188269 22:21121391-21121413 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181210929 22:21289102-21289124 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181398576 22:22637786-22637808 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181522721 22:23458777-23458799 GAGGGTTCCCAGAGGGCTGCCGG + Intergenic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1182552357 22:31107193-31107215 CAGGCTTCCACGGTGGATGCTGG + Intronic
1183087692 22:35496822-35496844 CAGGTGTCCCAGAGGAAAGCTGG + Intergenic
1183460082 22:37944539-37944561 CAGGTTCCCATGAGGGATGCAGG + Intronic
1183717109 22:39539970-39539992 CTGGCTTCCCAGAGGGATCAAGG - Intergenic
1184520856 22:44993145-44993167 CAGGAATCCCAGTGAGATGCTGG - Intronic
1184554438 22:45225558-45225580 AAGGCTCTCCAGGGGGATGCAGG - Intronic
1184802115 22:46767797-46767819 GAGGACTCCCAGAGCGATGCTGG + Intronic
1185295565 22:50052047-50052069 CGGGGTTCCCAGAGAGGTGCTGG - Intronic
1185324395 22:50218642-50218664 CAGGCATCCCACAGGCAGGCAGG + Intronic
1203216018 22_KI270731v1_random:6328-6350 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1203274604 22_KI270734v1_random:79062-79084 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
949192474 3:1266912-1266934 CTGGCTTCCCAGAGGTCTGAGGG - Intronic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
950440584 3:13007998-13008020 CTGGCTTCCTAGAGGAGTGCAGG - Intronic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
950724958 3:14911241-14911263 TAGGCCTCCCAGGGGGATGGTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952301762 3:32109637-32109659 CAACCTCCCCAGAGGGATTCAGG + Intronic
953847092 3:46436214-46436236 CAGGCTTCCAGGAGGGCTGTGGG + Exonic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
962267925 3:133956461-133956483 CAGGCTTCCCTGACTGATGGGGG - Intronic
962426277 3:135271722-135271744 CAGCCTCCCCCGAGGCATGCAGG + Intergenic
963799105 3:149658880-149658902 CAGGCTCCCCGGAGGGCGGCAGG - Intronic
966564837 3:181365095-181365117 CAGGCTTCCCAGATTACTGCTGG + Intergenic
967348413 3:188484887-188484909 CAAGCTTCCCAGAGTTCTGCTGG + Intronic
968759336 4:2433949-2433971 GAGGCTTCTCAGATGGATGTCGG - Intronic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
970332545 4:15001984-15002006 CGGGCTTCCCAGAGCGGGGCTGG - Intergenic
971295614 4:25387371-25387393 CAGGCTTCCCTTAGGAAAGCTGG - Intronic
974490363 4:62557063-62557085 CTGGTTACCCAGAGTGATGCAGG + Intergenic
974594160 4:63995509-63995531 AAGGCTTCCTAGAGGCATCCTGG + Intergenic
974627367 4:64442369-64442391 AAGGCTTCCCAGAGGCACCCTGG + Intergenic
975475838 4:74822224-74822246 CAAGCATTTCAGAGGGATGCTGG + Intergenic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
985670481 5:1204155-1204177 GAGGCTTCCAAGAGGGAACCAGG - Intronic
986470761 5:8072007-8072029 CAGGCTTCATGGAGGAATGCAGG - Intergenic
986737849 5:10681309-10681331 CATGCTTCCTACAGGGACGCTGG - Intronic
986737990 5:10681899-10681921 CATGCTTCCTGCAGGGATGCTGG - Intronic
986738011 5:10682017-10682039 CATGCTTCCTACAGGGATGCTGG - Intronic
986780697 5:11062708-11062730 AAGGCTTGCCAGGGGGATACAGG + Intronic
988082422 5:26430842-26430864 CAGGCTTTCCAGTGGGTTTCTGG + Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
994914133 5:105950860-105950882 CCTGCTTACCAGAGAGATGCAGG + Intergenic
997157214 5:131573585-131573607 CAGGCTTCCAAGAGGGCACCAGG + Intronic
997370788 5:133358358-133358380 CAGCCTTCCCAGGTTGATGCTGG - Intronic
1001209313 5:169795416-169795438 GAGGCTCGCCAGAGGGCTGCAGG + Intronic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001322840 5:170697156-170697178 CAGGCTTCCCTGAGGAGTGACGG - Intronic
1001716963 5:173824258-173824280 AAGGCTTCCAAGAGGAAGGCTGG - Intergenic
1002027413 5:176404849-176404871 GAGGCTGCCCAGGGGGATGTGGG - Intronic
1002068593 5:176665098-176665120 CAGGCGTCCCAGCTGCATGCGGG - Intergenic
1002078564 5:176724137-176724159 TCGGCTTCCCAGAGGGTTTCTGG + Intergenic
1003176090 6:3752670-3752692 GAGGCTTTCCAGAGCGCTGCCGG - Intergenic
1003328639 6:5111626-5111648 GAGGCGTCCCAGATGGATCCCGG - Intronic
1003435376 6:6083170-6083192 CATGCTTCCCAGATGGGAGCTGG - Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1012522628 6:100138810-100138832 CAGGCCTGCCAGAGTGATGATGG - Intergenic
1012976358 6:105784765-105784787 CAGGCTGCCCATGGGGATGTAGG + Intergenic
1013656672 6:112253971-112253993 CAGGCGTCCCAGAGCCACGCGGG + Exonic
1014772862 6:125476558-125476580 CAGGCTTCCCAGAGTGCTTGTGG - Intergenic
1015237576 6:130988532-130988554 CAGGCTTTCCTGAGGGGTGGCGG + Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017720668 6:157241053-157241075 CAGGTTTCCAAGGGGGATCCCGG + Intergenic
1019119306 6:169790577-169790599 CAGGCTTCCCTCACGGAGGCGGG - Intergenic
1019538896 7:1542739-1542761 CCGGCTTCCCAAAGAGATCCAGG + Exonic
1019588604 7:1817760-1817782 GAGGGTTCCCAGAGGGCTGCCGG - Intronic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1021414293 7:20364598-20364620 AAGGCTTCCCAGATGGACTCTGG + Intronic
1021625603 7:22590042-22590064 CAGCCTTTCCAGAGGAATGTGGG + Intronic
1022472551 7:30690762-30690784 TAGGCTTCCGGGAGGGGTGCAGG - Intronic
1023392798 7:39726567-39726589 CAGGCTGCCCTCAGGGTTGCAGG + Intergenic
1023680771 7:42684999-42685021 CAGGCTTTCTAGAGAGATGAGGG + Intergenic
1028860307 7:95641648-95641670 CTGGCTCCACAGAGAGATGCTGG - Intergenic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1032085238 7:128880292-128880314 CAGGCATCAGAGAGGGAGGCTGG - Intronic
1035574231 8:694998-695020 CTGCCTTTCCCGAGGGATGCTGG - Intronic
1036223646 8:6940868-6940890 CTGGCATCCCAGAGAGCTGCTGG - Intergenic
1038049864 8:23798457-23798479 CAGGCTCCCCAGAGGGCTCGAGG + Intergenic
1039305047 8:36252198-36252220 CATGCTGCTCAGAGGGATTCTGG - Intergenic
1039894578 8:41707427-41707449 CAGGCTGCCCAGAGGCTTGTGGG + Intronic
1041541555 8:58990677-58990699 CAAGCATCCCAGAGGTCTGCAGG + Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046171408 8:110512292-110512314 CTGGCTTCCCTGAGGGCTGAGGG + Intergenic
1046930000 8:119832591-119832613 CCGGCTTCCTAGGGGGATACGGG + Exonic
1047779277 8:128098356-128098378 CAGGCCTGGCAGAGGGGTGCAGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048924524 8:139259632-139259654 CTGGACTCCCAGAGGGATACGGG - Intergenic
1049264378 8:141659612-141659634 CTGGCTTCCCAGGGAGCTGCTGG - Intergenic
1049387611 8:142352096-142352118 CAGGCCTCCCAGTGAGAAGCCGG + Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1050341211 9:4640646-4640668 CAGTCTTCCTAGTGTGATGCTGG - Intronic
1051735126 9:20190020-20190042 ATGGCTTCCCAGTGGGGTGCCGG - Intergenic
1052037314 9:23697017-23697039 CAGTCTTCCCCCAGGGAGGCAGG - Intronic
1056069207 9:82968442-82968464 CAGGCTTCCCTGAAGGCTCCAGG + Intergenic
1056720022 9:89063540-89063562 CCTACTTCCCAGAGGGATGAAGG + Intronic
1057854036 9:98588922-98588944 CAGGCTTGCCATAGGGATTTGGG - Intronic
1060560369 9:124537674-124537696 CAGGCTAGCCATGGGGATGCTGG + Intronic
1060608666 9:124940970-124940992 CTGGCTTCCCAGAGAGAGGCAGG - Exonic
1060952410 9:127612520-127612542 CAGGCCTCCGAGCGGGCTGCCGG + Intronic
1060985160 9:127815529-127815551 CAGGCCTCTGAGAGGGAGGCGGG + Exonic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061484554 9:130913826-130913848 CAGGCATCCCAGGGGGCTTCGGG - Intronic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1186277589 X:7956815-7956837 CTGCTTTCCCAGAGGGATACAGG + Intergenic
1189494937 X:41500139-41500161 CAGGCTTCCCACAGGGTGGGAGG - Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1192147303 X:68690125-68690147 CAGGCTTCGTTGAGGCATGCGGG + Intronic
1194935875 X:99948214-99948236 CAGATTTCCCAGAGTGATGAAGG - Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1199172359 X:144746162-144746184 AAGGCTTCCCAGAGGCACCCTGG - Intergenic
1200161733 X:154013117-154013139 CCGGCCTCCCTGAGGGGTGCTGG + Exonic
1200954926 Y:8934514-8934536 CAGGCTGCCAACAGGGATGAAGG - Intergenic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic