ID: 1171492538

View in Genome Browser
Species Human (GRCh38)
Location 20:25531654-25531676
Sequence CTCACGAAGAGGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171492538 Original CRISPR CTCACGAAGAGGAAGGAGCA GGG (reversed) Intronic
900130177 1:1084087-1084109 CTCGGGAACAGGAAAGAGCATGG + Intronic
900269889 1:1781633-1781655 CTCAGGCAGAGGCAGCAGCAAGG + Intergenic
901157104 1:7148447-7148469 CACAGGGAGAAGAAGGAGCATGG - Intronic
901733489 1:11297301-11297323 CTCCCATGGAGGAAGGAGCAAGG - Intergenic
902058195 1:13619499-13619521 TTCATGAATAGGAAAGAGCAAGG + Intergenic
906980116 1:50620967-50620989 CTCAGGCAGAGGCTGGAGCAGGG + Intronic
907269602 1:53283198-53283220 CTCACGTGGTGGAAGGGGCAAGG - Intronic
908438525 1:64130653-64130675 CTCCAGAAGAGGAAGGAGGTAGG + Intronic
908798893 1:67858623-67858645 CTCACTAAGAGGAAGAAGGATGG - Intergenic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
910827910 1:91428696-91428718 CTCGAGAAGTGCAAGGAGCAGGG - Intergenic
911418887 1:97613946-97613968 CTCACGAAGAGCCAGGGGGAGGG + Intronic
911464247 1:98232637-98232659 CTCACAGAGAGGAAGGAAAAGGG + Intergenic
911530635 1:99039433-99039455 CCCAGGAAGTGCAAGGAGCATGG + Intergenic
912953770 1:114138164-114138186 GTCAAGAAGAGGAAGGAAAAGGG - Intronic
914077496 1:144369073-144369095 CTCACATGGAGGAAGGGGCAAGG + Intergenic
914101683 1:144597432-144597454 CTCACATGGAGGAAGGGGCAAGG - Intergenic
915453015 1:156020102-156020124 CTCAAGCAGAGGAAGGAGCCAGG - Exonic
916473840 1:165149435-165149457 CTTACGCAGTGGAAGGGGCAAGG + Intergenic
917173365 1:172202126-172202148 CTCATGGAGAGGAATGAACAGGG - Intronic
918067871 1:181113588-181113610 GCCACCAAAAGGAAGGAGCAGGG - Intergenic
918152802 1:181812840-181812862 CTCACAAAGAGTAAGATGCAAGG + Intergenic
918282913 1:183023394-183023416 CCCCCGGGGAGGAAGGAGCAGGG - Intergenic
918477987 1:184946465-184946487 CTCAAAAAGAGGAAAGAGGAAGG + Intronic
919066351 1:192696571-192696593 CTCACGTGGTGGGAGGAGCAAGG - Intergenic
922474816 1:225899468-225899490 GTCATGCAGAGGAAGGAGCCTGG - Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924371825 1:243359132-243359154 GTCACCAAGAGGAAGGAGGAAGG - Intronic
1068689379 10:59900278-59900300 CTGACAAAGAGGAAGTATCAGGG + Intronic
1068934344 10:62621608-62621630 CTTACCAAGAGGCAGGAGTAAGG - Intronic
1069036990 10:63656025-63656047 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1069959352 10:72070462-72070484 GTGACAATGAGGAAGGAGCAGGG + Intronic
1070841619 10:79491564-79491586 ATCACCAAGAGGAACTAGCATGG - Intergenic
1072619554 10:97070653-97070675 CTCACACGGAGGAAGGGGCAAGG - Intronic
1073971187 10:109046655-109046677 ATCAAAAAGAGGAAGGAGAAGGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074129302 10:110559137-110559159 TTCACGAAGAGGAAGGATGAAGG - Intergenic
1075549486 10:123381657-123381679 CACAGGAGGAGCAAGGAGCAAGG + Intergenic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076314770 10:129532505-129532527 CCCACCCGGAGGAAGGAGCAGGG - Intronic
1076983627 11:219326-219348 CTCACAAAGAGGAGGCAGGAAGG - Intronic
1077154189 11:1084155-1084177 CTCACGGGGAGGAAGGGGCCTGG + Intergenic
1077815478 11:5682368-5682390 CCCACGGAGAGGGAGGAGCAAGG + Intronic
1077924068 11:6663118-6663140 CTCATGGAGAGAATGGAGCAAGG + Intergenic
1078192823 11:9106566-9106588 GTAAAGAAGAGCAAGGAGCAAGG + Intronic
1078507490 11:11963657-11963679 CTCCCCAAAAGGAAGGAGAATGG - Exonic
1078634762 11:13039102-13039124 CTCACACAGAGGTAGGAACATGG + Intergenic
1078972550 11:16430570-16430592 CTCACAAGGAGGAAAGGGCAAGG - Intronic
1079428220 11:20363864-20363886 CTCACGACGCAGCAGGAGCAGGG - Exonic
1079776497 11:24536959-24536981 CTGAGGAAGAGGAAGGCCCAAGG + Intronic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1081059485 11:38455644-38455666 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1082975069 11:59063073-59063095 CCCATGAGAAGGAAGGAGCAGGG + Intergenic
1083665213 11:64270405-64270427 CTCACTTAGAGGAAGGCTCACGG - Intronic
1083794167 11:65005017-65005039 CACACGGACAGGAAGCAGCAGGG - Intergenic
1084735530 11:71103001-71103023 CTCACAAAGTGGAAGGAGCGAGG + Intronic
1085016125 11:73175092-73175114 CCCAAAAAGAGGAAAGAGCAAGG + Intergenic
1085298204 11:75442769-75442791 CTTACCAAGAGGACGGAGGACGG + Intronic
1086192359 11:84094628-84094650 CTCACATAAAGGAAGGGGCAAGG + Intronic
1087303537 11:96462727-96462749 CACACTCAGAGGGAGGAGCATGG - Intronic
1087876233 11:103361289-103361311 CTCACGTGGAGGAAGGGGTAAGG - Intronic
1087947808 11:104185446-104185468 CTCACATAGTGGAAGGGGCAAGG - Intergenic
1088367943 11:109058580-109058602 CTCACCAAGTAGAGGGAGCAGGG - Intergenic
1088648381 11:111936695-111936717 CTAAAGAAGAGGAAGCAGAAGGG - Intronic
1089571233 11:119411765-119411787 CTCATGTAGTGGAAGGAGTATGG + Intergenic
1090083942 11:123634259-123634281 CACAAGATGGGGAAGGAGCAGGG + Intronic
1090198640 11:124838729-124838751 CTCCAGCAGAGGAGGGAGCAGGG - Intergenic
1090567026 11:128006211-128006233 CTCACGAGGAGGAATGAAAAGGG + Intergenic
1090771119 11:129920647-129920669 CTCAAGCAGAGGGAGCAGCAGGG - Intronic
1091219725 11:133922890-133922912 GTCACGAAGAGGAAGAAGAGAGG + Intronic
1091699776 12:2651864-2651886 GCCACACAGAGGAAGGAGCAGGG - Intronic
1092977080 12:13755883-13755905 CTCACAGGGTGGAAGGAGCAAGG - Intronic
1096078820 12:48820452-48820474 CTCAGGGAGAGCAAGGAGCCAGG - Intronic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1097210824 12:57368291-57368313 CTAACTAAGAGGAAGGGGAAGGG - Intronic
1097683917 12:62674757-62674779 TACACGAAGAGGAAGCTGCAGGG + Intronic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098641097 12:72839185-72839207 CTCAGGCTGGGGAAGGAGCAAGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100970211 12:100061781-100061803 ATCACGAAGGGAAAGAAGCAGGG + Intronic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102812909 12:115839796-115839818 CTCACGTGGTGGAAGGAACAAGG + Intergenic
1102854613 12:116282567-116282589 CTGACTAACAGGAAGCAGCAAGG + Intergenic
1103335233 12:120184282-120184304 CTCAGGCAGAGGCAGGGGCAAGG + Intronic
1103610871 12:122123513-122123535 CTCACGGAGAGGAAGAAGAGGGG + Intronic
1103825192 12:123732324-123732346 CTAAGGCAGAGGCAGGAGCAGGG - Intronic
1104185352 12:126425315-126425337 CTCTCAGAGAGGAAGGGGCATGG + Intergenic
1104250834 12:127092125-127092147 GACAGGAACAGGAAGGAGCATGG - Intergenic
1105335178 13:19460449-19460471 CTCACAAAGAGGAATGAAAAGGG - Intronic
1105563592 13:21519798-21519820 CTGACAATGAGGAAAGAGCAGGG + Intronic
1105859740 13:24398937-24398959 CTCACAAAGAGGAATGAAAAGGG + Intergenic
1106401825 13:29438513-29438535 CTCACACGGAGGAAGGGGCAAGG + Intronic
1107086316 13:36431495-36431517 CCCAGGAAGAGGAAGGAACGCGG - Intergenic
1107791177 13:44003854-44003876 CTCACATAGTGGAAGGAGGAAGG - Intergenic
1109321864 13:60819917-60819939 GTTATGAATAGGAAGGAGCATGG + Intergenic
1109977026 13:69851646-69851668 GTCCAGAAAAGGAAGGAGCAAGG - Intronic
1111615550 13:90658264-90658286 CTCACGGAGAGGAATGAAAAGGG + Intergenic
1112103600 13:96216941-96216963 ATCAGGAATCGGAAGGAGCAGGG - Intronic
1112160088 13:96858110-96858132 GTCACAAAGATGAAGAAGCAGGG - Intergenic
1112523747 13:100122881-100122903 CTCACATGGTGGAAGGAGCAAGG + Intronic
1112625406 13:101098045-101098067 CGAACAAGGAGGAAGGAGCATGG - Intronic
1112782881 13:102921064-102921086 CTCACTAAGTGGAAGAAGCCTGG - Intergenic
1112841505 13:103584894-103584916 CTCACAGAGTGGAATGAGCAAGG + Intergenic
1113248497 13:108425597-108425619 CTCACATAGTGTAAGGAGCAAGG + Intergenic
1113605272 13:111600320-111600342 CTGACCAAGACGCAGGAGCAGGG + Intronic
1114768428 14:25401306-25401328 CTCAGGAAGATTAAGGAGCCTGG - Intergenic
1115171429 14:30512184-30512206 CTCACAAGGTGGAAAGAGCAAGG + Intergenic
1115581606 14:34764706-34764728 CTCAAGAAGAGGAAGAAGTCAGG - Exonic
1116881828 14:50178294-50178316 CAAAGCAAGAGGAAGGAGCAGGG - Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117538584 14:56724976-56724998 CTCACCTAGATGAAGGAGGATGG - Intronic
1117780286 14:59224865-59224887 CTCACACAGTGGAAGGAGCAAGG - Intronic
1117850138 14:59958869-59958891 CCCAGGAAGTGCAAGGAGCAGGG - Intronic
1119195282 14:72713161-72713183 TCCAGGATGAGGAAGGAGCAGGG - Intronic
1119568881 14:75652337-75652359 CTCATGGGGAGTAAGGAGCAAGG + Intronic
1121415269 14:93774935-93774957 ATCACGAAGAGGAAAGAGCAGGG + Intronic
1122900594 14:104780734-104780756 CCCACCAGGAGGATGGAGCATGG + Intronic
1202856923 14_GL000225v1_random:57778-57800 GAGACGAAGAGGAAGGGGCAGGG - Intergenic
1125550511 15:40541163-40541185 CTCACGCAGAGGAGAGAGGAGGG - Intronic
1127118565 15:55751266-55751288 CTCAGGAGGAGGCAGGAGAATGG - Intergenic
1128941361 15:71790439-71790461 CACATGGAGAGGAAGAAGCAGGG - Intergenic
1129873489 15:78956837-78956859 CTCAGGAAGAGCAAAGAGTAGGG + Intergenic
1131461804 15:92622821-92622843 CTCTCACAGAGGAAGGAACAGGG - Intronic
1132588741 16:717247-717269 CCCATGAAGAGGAAGGTGCCTGG - Exonic
1132949694 16:2554222-2554244 CTGAAGAGGAGGCAGGAGCAAGG + Intronic
1132964654 16:2645945-2645967 CTGAAGAGGAGGCAGGAGCACGG - Intergenic
1133739354 16:8639946-8639968 CTCAGGCAGAGGGAAGAGCAAGG - Intronic
1134913206 16:18047441-18047463 CCCAGGAAGAGGAAAGAACATGG - Intergenic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1137869306 16:51934129-51934151 CCCAGGCAGAGGAAGGGGCAAGG + Intergenic
1139344808 16:66296149-66296171 CTCAAGACAGGGAAGGAGCAAGG - Intergenic
1139582795 16:67883320-67883342 TCCAGGAAGAGGAAGCAGCAGGG - Intronic
1140117124 16:72051644-72051666 CTCAAGAGGAGGTAGGAGGAAGG - Intronic
1141173940 16:81707233-81707255 GTGACAAAGAGGAAGCAGCAGGG + Intronic
1141593687 16:85085008-85085030 CTCAGGAAGAGGAGGGGTCAGGG + Intronic
1141810595 16:86373035-86373057 CTCACGGATAGGATGGTGCAGGG - Intergenic
1142889970 17:2936848-2936870 AAAACGAAGAGCAAGGAGCATGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144121604 17:12159817-12159839 CTCAGGAGGCGGAAGGTGCAGGG - Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146460913 17:33045483-33045505 CTCACCCACAGGAAGGAGCCTGG + Intronic
1147417763 17:40306002-40306024 CTCAGGATGAGGCAGGAGAATGG - Intergenic
1148045084 17:44738535-44738557 CTCAGGAAGATGAAGGTGCAGGG - Intronic
1148507550 17:48139913-48139935 CTCTCGGAAAGGAAGGAGGAGGG - Intronic
1148512665 17:48186001-48186023 CTCACGGTGAGAGAGGAGCAGGG - Intronic
1148534118 17:48424182-48424204 CTCACATAGTGGAAGGAGTAAGG + Intronic
1150041214 17:61863402-61863424 CCCAGGAAGAGGGAGGAGGAAGG - Exonic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1152135636 17:78501639-78501661 CCCAGGAAGAGGAAGTGGCAGGG + Intronic
1152494847 17:80663791-80663813 CTCAAGCAGAGGAAGGCACAAGG - Intronic
1152667477 17:81579667-81579689 CACACAGAGAGGAAGGGGCATGG - Intronic
1153119119 18:1700148-1700170 CTCAGGAAGCGCAAAGAGCAGGG + Intergenic
1153967643 18:10196191-10196213 CTCACGTGGCAGAAGGAGCAAGG + Intergenic
1155281472 18:24245024-24245046 CTAGCGAAGAGGAAAGAGTAAGG - Intronic
1155572334 18:27209429-27209451 CTCACAAAGAGGAAAGATAATGG + Intergenic
1158672156 18:59486095-59486117 CTCAGCAAGATTAAGGAGCAAGG - Intronic
1159270377 18:66141556-66141578 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1160337232 18:78053592-78053614 CTCACTCAGCTGAAGGAGCAAGG + Intergenic
1160696105 19:485299-485321 AACACGAAGAGGCAGGAGCCGGG + Intergenic
1161167612 19:2796717-2796739 CTCCCGAGGAGGCAGGGGCAGGG - Intronic
1162550010 19:11353454-11353476 CTGACCAAGATGAAGCAGCAGGG + Exonic
1162949381 19:14061711-14061733 TCCCCGAAGAGGAAGGGGCAGGG + Intergenic
1163755844 19:19105798-19105820 GGCACGAAGAGGAGGGAGCGGGG - Intronic
1163972046 19:20807920-20807942 CTCACGAAGCGCAAGGAGTCAGG + Intronic
1164047616 19:21555896-21555918 CCCACGAAGTGCAAGGAGCTGGG - Intronic
1164064771 19:21706429-21706451 CACAGGATGAGGAAGGAGCACGG + Intergenic
1165094683 19:33403607-33403629 CTCATGTGGAGCAAGGAGCAGGG + Intronic
1165906111 19:39196038-39196060 GTCACGAGGAGGTGGGAGCAAGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168345522 19:55648613-55648635 CTAAGGAAGAGGCAGGTGCAGGG - Exonic
1168457050 19:56520681-56520703 CTCACACAGTGGAAGGGGCAAGG - Intronic
1168654558 19:58117946-58117968 CCAACGAAGAGGAGGGAGTAGGG + Intronic
925032513 2:661661-661683 CACACGAAGAGAAAGGATGAAGG - Intergenic
925925858 2:8669818-8669840 CTAAGGAAGAGGAAAGAGCTTGG - Intergenic
928174201 2:29023081-29023103 CTCAGGCAGATGAAGGAGAAGGG + Exonic
928399543 2:30967945-30967967 CTCAGGTAGAGGAAGGAGAAAGG - Intronic
929235625 2:39602509-39602531 CTCAGTAATAAGAAGGAGCAAGG - Intergenic
930216435 2:48701948-48701970 CTCACTAAGGGCAAGGACCAGGG + Intronic
931146628 2:59526669-59526691 CTCACATAGTGGAAGGGGCAAGG - Intergenic
932074962 2:68654221-68654243 CCCAAGAACAGGAAGGAGCTGGG + Intronic
932864105 2:75323665-75323687 CTAAGGAAGAGGAGGGAGAAGGG - Intergenic
932926933 2:75987413-75987435 ATCACGAGGTGGAAGGGGCAAGG + Intergenic
933424521 2:82092778-82092800 CTCACGCAGTGGAAAGAGCAAGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934983916 2:98870245-98870267 CTCAGGAACAGGCAGCAGCAAGG + Intronic
935484453 2:103636052-103636074 CTAATGCAGAGGCAGGAGCAAGG + Intergenic
937087423 2:119180737-119180759 TTTAGGAAGAGGAAGGAACATGG - Intergenic
938165566 2:129022659-129022681 CTCCCGAAGAGCAAAGGGCATGG - Intergenic
938225750 2:129614711-129614733 CACAAGAACAGGAAGGAGGAGGG + Intergenic
939729753 2:145768121-145768143 CTCACAAAGATGAAGAAGCAGGG + Intergenic
940009362 2:149038454-149038476 CTCAGGAAGTGAAAGAAGCACGG - Exonic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942387574 2:175458732-175458754 CTCACTTAGAGGAGGTAGCATGG + Intergenic
944783739 2:203046663-203046685 CTCACACAGAGGAAGGGGCAGGG + Intronic
946342929 2:219083419-219083441 CACTCAAAGAGGAAGAAGCAAGG + Intronic
947142149 2:227029294-227029316 GTCACCAAGAGGAAGGAGGAAGG - Intronic
948027093 2:234786920-234786942 CTCACGTAGTGGAAGGGGCAAGG + Intergenic
948970344 2:241420922-241420944 CTCACGAAGAGGAAAGAAAAGGG + Intronic
1168927678 20:1596178-1596200 TTCCTGAAGAGGAAGGAGAAAGG + Intronic
1168977313 20:1976945-1976967 CTCAAGAAGAAAATGGAGCATGG - Intergenic
1170121263 20:12915066-12915088 TTCAGGAAGAGGAAGTAACAAGG - Intergenic
1170653081 20:18260651-18260673 ATCATTAAAAGGAAGGAGCATGG + Intergenic
1170766385 20:19292903-19292925 CTCACACTGAGGAAGGGGCAAGG + Intronic
1171221187 20:23399385-23399407 CTCACGTGGTGGAAGGAACAAGG - Intronic
1171492538 20:25531654-25531676 CTCACGAAGAGGAAGGAGCAGGG - Intronic
1172555226 20:35834978-35835000 CTCAAGAAGAGGTAGGAGGCCGG + Intronic
1172681368 20:36718355-36718377 CTCAGGGAGAGAAAGGAGTAAGG + Intronic
1175750097 20:61490321-61490343 CACACGAAGCGGAAGGGGCCTGG + Intronic
1175952896 20:62592765-62592787 CTCGCCATGAGGAAGGGGCATGG + Intergenic
1176738397 21:10574537-10574559 CTCACAAAGAGGAATGAAAAGGG + Intronic
1177223785 21:18227097-18227119 CTCACATAGTGGAAGGGGCAAGG + Intronic
1179783457 21:43717163-43717185 AGCACTAAGAGGAAAGAGCAGGG - Intergenic
1179835302 21:44027864-44027886 CTCACGTGGGGGAAGGGGCAAGG - Intronic
1179954677 21:44731932-44731954 CTCACACAGTGGAAGGGGCAAGG + Intergenic
1181523001 22:23460057-23460079 CCCAGGTGGAGGAAGGAGCAAGG + Intergenic
1182265540 22:29112104-29112126 TCCACGAAGAGGAAGAAGGATGG - Intronic
1182547382 22:31084111-31084133 CTCAGGAAGAGGAACAAGAAAGG - Intronic
1182742591 22:32579419-32579441 CTCACACAGCGGAAGGGGCAAGG + Intronic
1183542216 22:38436006-38436028 CTCATGAAGAGGAGGGAGTCAGG - Intronic
1184290216 22:43494909-43494931 CTTACATAGTGGAAGGAGCAAGG + Intronic
1185019735 22:48367147-48367169 CTCACATGGAGGAAGGAGGAGGG + Intergenic
949319619 3:2794856-2794878 CTCACGTGGTGGAAGGGGCAAGG + Intronic
949379916 3:3433108-3433130 CTGACTAGAAGGAAGGAGCAAGG + Intergenic
950005742 3:9689944-9689966 CTCCTGCAGTGGAAGGAGCAGGG - Exonic
950569327 3:13790492-13790514 GTCGCCAAGAGGAAGCAGCAGGG + Intergenic
951080836 3:18447908-18447930 CTCACACAGTGGAAGGGGCAAGG - Intergenic
952548762 3:34451054-34451076 CTCACGGAGAGGAATGAAAAGGG - Intergenic
952787595 3:37171118-37171140 CTTAATAAGAGGAAGAAGCAGGG + Intronic
953160337 3:40413942-40413964 CTCAGGAAGAAGAAAGAGCAAGG - Intronic
953705843 3:45229594-45229616 CTCAGGCAGAGGAAAAAGCATGG - Intergenic
954858571 3:53667894-53667916 TTCATAAAGAGGAAGGAGGAAGG + Intronic
954905490 3:54058982-54059004 CCCAGGAAGAGGGAGCAGCATGG - Intergenic
955454044 3:59100769-59100791 CTCAAGGAGTGCAAGGAGCAGGG - Intergenic
956041557 3:65150390-65150412 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
956265536 3:67392280-67392302 AACACCAGGAGGAAGGAGCAAGG - Intronic
957224891 3:77430643-77430665 CTCCTGTAGTGGAAGGAGCAAGG - Intronic
959349835 3:105248305-105248327 CTCACGTGGTGGAGGGAGCAAGG - Intergenic
960260110 3:115557665-115557687 CTCACATAGTGGAAGGAGCAAGG + Intergenic
960629056 3:119710384-119710406 CTCACGTGGAGGAAGGTGGAAGG + Intronic
962898243 3:139735226-139735248 TGAATGAAGAGGAAGGAGCAGGG - Intergenic
963010787 3:140768378-140768400 CTCACATGGTGGAAGGAGCAAGG - Intergenic
963771752 3:149393302-149393324 CTCTGGCAGAGGAAGTAGCATGG - Intergenic
963778776 3:149465850-149465872 GTCAAGAGGAGAAAGGAGCAGGG + Intergenic
965312436 3:167147133-167147155 CTCAAAAAGAGGAATGAGCTTGG + Intergenic
965478246 3:169184590-169184612 CTGAGGAAGAGGTAGGAGCTAGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966582576 3:181584775-181584797 CTCAGGAGGTGGAAGGAGCTCGG + Intergenic
968115424 3:196085668-196085690 CTCATGAAGAGGAAGGATGAAGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968567614 4:1322489-1322511 CTCCGGAAGATGAAGGTGCACGG + Exonic
968650103 4:1757069-1757091 GGCACCAAGAGGAAGGAGGATGG - Intergenic
969244674 4:5924665-5924687 CTCTCGGGGAGGAAGGAGGAGGG + Intronic
970550677 4:17177967-17177989 CTCACATGGAGGAAGGGGCAAGG + Intergenic
970559067 4:17265189-17265211 CTCACAAGGTGGAAGGGGCAAGG + Intergenic
970888611 4:21016401-21016423 CTCAGGATGAGGCAGGAGAATGG - Intronic
970998800 4:22299083-22299105 TTCAAGAAGAGGGAAGAGCATGG - Intergenic
971276183 4:25199308-25199330 CTAACACAGAGGAAGGAGCATGG - Intronic
973244484 4:47996216-47996238 CTCCCTAAGAGGAGGGATCATGG - Intronic
974074804 4:57158704-57158726 CTCACCAATTGTAAGGAGCAGGG + Intergenic
976030949 4:80752290-80752312 CTCAGGAAGAGGAATGAAAAGGG - Intronic
977257171 4:94754232-94754254 TCCATGAAGAGGAAGGAGAAGGG + Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
978787168 4:112622761-112622783 CTCTCAAAGAGGAAAAAGCATGG - Intronic
979518773 4:121642077-121642099 GACACAAAGAGGAAAGAGCAAGG + Intergenic
980614584 4:135202325-135202347 CTCACATGGAGGAAGGGGCAAGG - Intergenic
980889795 4:138802376-138802398 CTCACTAAGGGAAAGAAGCATGG + Intergenic
981577253 4:146218199-146218221 CTCAGGAAGATGCAGGGGCAGGG + Intergenic
981855551 4:149286424-149286446 ATCACAGAGAGGAAGGAGCTAGG + Intergenic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
984232905 4:177120764-177120786 TTCACGGAGAGGCAGGAGGAAGG - Intergenic
984573803 4:181424051-181424073 CTAACAATGAGGAAGCAGCATGG + Intergenic
985575846 5:673245-673267 CTCAGGAAGAGAGAGGAGCAGGG - Intronic
986618836 5:9648825-9648847 CTCATGAAGAGGAAGAAGGCAGG + Intronic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987417147 5:17674254-17674276 CTCATGTGGAGGAAGGAGGAAGG + Intergenic
987477404 5:18408557-18408579 CTCACACGGTGGAAGGAGCAAGG - Intergenic
987627577 5:20422228-20422250 ATCAGGAAGAGAAAGGAACATGG + Intronic
989590716 5:43110850-43110872 CTCCCGTAGAGGAAGGAGGTGGG + Intronic
989668214 5:43881925-43881947 CTGACAAAAAGGAAGGAGCAAGG + Intergenic
989797213 5:45490465-45490487 CTCAGAAAGAGGAAGGGACAAGG - Intronic
990400974 5:55436987-55437009 CTCACACAGTGGAAGGGGCAAGG - Intronic
990843926 5:60115322-60115344 CTCATGATGAGGAAGGAACATGG - Intronic
991184642 5:63793149-63793171 TTCAGGCAGAGGAAAGAGCAAGG + Intergenic
993032557 5:82721946-82721968 CTCACTAGGTGCAAGGAGCAGGG + Intergenic
993363734 5:87009504-87009526 TTCTCTGAGAGGAAGGAGCAAGG + Intergenic
993819650 5:92599351-92599373 CTCAGTAAGAAGAAGGAACAGGG + Intergenic
994011198 5:94905096-94905118 CTAAAGAAGATGAAGAAGCAAGG + Intronic
995785808 5:115826162-115826184 TGCAGGAAGTGGAAGGAGCAGGG - Intergenic
995830505 5:116349362-116349384 CTGATGAAGAGGAAAAAGCAGGG + Intronic
996315101 5:122152688-122152710 CTCATGAATAGGAAGGGACAGGG - Exonic
999304243 5:150509464-150509486 CTAAGGAAGAGGCAGGAGCGAGG - Intronic
1000004559 5:157170962-157170984 CTCAGTCAGAGGAAGCAGCAAGG + Intronic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1002205921 5:177562512-177562534 CTCAAGGAGAGGAAGGGGCTTGG - Intergenic
1004522674 6:16377083-16377105 CTCACATGGTGGAAGGAGCAAGG - Intronic
1004873479 6:19931656-19931678 TTCAGGCAGAGGAAGGAGCCAGG + Intergenic
1004951851 6:20681995-20682017 CTCACACAGTGGAAGGGGCAAGG + Intronic
1006910156 6:37558429-37558451 CTCACTAAGAAGAGGGAGCATGG + Intergenic
1007241110 6:40425763-40425785 CTCAGGAAGAGCAAGCAGCTTGG + Intronic
1008421207 6:51301194-51301216 CTCATGTAGAAGAAGGGGCAAGG + Intergenic
1008482902 6:52005432-52005454 CACAGGAATAGCAAGGAGCATGG - Intronic
1009908364 6:69895601-69895623 CACAGGAAGAGGAAGGGCCAGGG + Intronic
1010326336 6:74567375-74567397 CTCACAAAGTGGAAGGAGTCTGG - Intergenic
1010765551 6:79774424-79774446 CTCACACAGTGGAAGGGGCAAGG + Intergenic
1010986965 6:82435696-82435718 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1014153607 6:118086710-118086732 CTCAGTAAGAGGAAAGACCACGG - Intronic
1014775907 6:125509625-125509647 CTCACGTGGTGGAAGGGGCAGGG - Intergenic
1016563517 6:145424750-145424772 CTCACGTGGTGGAAGGAGCAAGG - Intergenic
1016894825 6:149041493-149041515 CTCCAGAAGAGCAAGGGGCATGG - Intronic
1016991884 6:149935791-149935813 CTTAATAGGAGGAAGGAGCAGGG - Intergenic
1017174438 6:151489877-151489899 CTCACATGGAGGAAGAAGCAAGG + Intergenic
1017187488 6:151616810-151616832 CTCACATGGTGGAAGGAGCAAGG + Intronic
1017561876 6:155636785-155636807 CTCCCGAAGAGGACAGGGCAGGG + Intergenic
1017804813 6:157935506-157935528 CCCACGAAAAGAAAGGTGCAGGG + Intronic
1018756730 6:166856314-166856336 CTCACGTGGTGGAAGGGGCAAGG - Intronic
1018979655 6:168592753-168592775 CTCAGGAAGAAGGAGGAGCTCGG - Intronic
1018979706 6:168593008-168593030 CTCAGGAAGAAGGAGGAGCTCGG - Intronic
1019102236 6:169640877-169640899 CTCACTAAGAAGGAAGAGCATGG - Intronic
1019588332 7:1816506-1816528 CCCAGGTGGAGGAAGGAGCAAGG - Intronic
1019848768 7:3533364-3533386 CTCATGAAAAGGAAAGACCAAGG + Intronic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1023384999 7:39647728-39647750 CTCACATGGTGGAAGGAGCAAGG - Intronic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024196304 7:47062253-47062275 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
1024586894 7:50849845-50849867 CTCAGGATGAGGAAGAAGGAGGG - Intergenic
1026584012 7:71641549-71641571 CTCACGTAGTGGAAGGAGTGAGG + Intronic
1028476782 7:91262945-91262967 CTGACGGAGAGGTAGGTGCAAGG - Intergenic
1029477931 7:100796204-100796226 CACAGGAGGAGGAAGCAGCAGGG - Intronic
1030389728 7:108911945-108911967 GTCACAAAGAGGAAGAACCATGG + Intergenic
1030661572 7:112224520-112224542 ATCACTAAGAGGAAGCATCAGGG + Intronic
1030830344 7:114211569-114211591 CTCACAAAGAGGAATGTGAACGG - Intronic
1030921213 7:115390965-115390987 CCCACAAAGATGCAGGAGCATGG + Intergenic
1030995363 7:116352903-116352925 GTCAAGAAGTAGAAGGAGCATGG - Intronic
1031208722 7:118794639-118794661 GTCATGAACAAGAAGGAGCATGG + Intergenic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032832792 7:135645300-135645322 CTCCTCAAGAGGAAGCAGCAAGG - Intronic
1034437746 7:151071222-151071244 CTCAAGAAGCGAGAGGAGCAGGG + Exonic
1035220775 7:157405448-157405470 ACCACGAGGAGGAAGGAGCTGGG - Intronic
1037697059 8:21232871-21232893 CCAAAGAAGAAGAAGGAGCAAGG + Intergenic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038643469 8:29345526-29345548 CTAACGAAGAGGAAGCACGATGG - Intronic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1041258213 8:55997492-55997514 CTCACGTGGTGGAAGGGGCAAGG + Intronic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041466228 8:58160091-58160113 CTAAGGGAGAGGAAGGAGCAAGG - Intronic
1042242925 8:66682640-66682662 CTCACTTACAGGAAGGATCAGGG - Intronic
1042295808 8:67216329-67216351 CTCACGTGGTGGAAGGAGGAGGG - Intronic
1043057183 8:75453734-75453756 CTCACGAAGAAGACAGATCAAGG - Intronic
1043528849 8:81127815-81127837 TTCTCCAAGAGGAAGGTGCATGG + Intergenic
1044174006 8:89094182-89094204 CTCACTTAGTGGAAGGGGCAAGG + Intergenic
1044650753 8:94491839-94491861 ACCACCAAGAGGAAGGGGCAGGG - Exonic
1045345173 8:101287603-101287625 TTCAAGAAGAGGAAAGAGCAGGG - Intergenic
1047523683 8:125615051-125615073 CTCACTCAGCTGAAGGAGCAAGG - Intergenic
1047567714 8:126063679-126063701 GTCAAGAGGAGGAAAGAGCATGG - Intergenic
1047734132 8:127750983-127751005 CTCAGGCAGAGGAAAGAGCAAGG - Intergenic
1048016311 8:130500545-130500567 CTCAGGACCAGGGAGGAGCAAGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048295812 8:133212580-133212602 CTCAAGAAAGGAAAGGAGCAGGG + Intronic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1049021914 8:139962900-139962922 CTCAGGAAGCCGGAGGAGCAAGG + Intronic
1050005802 9:1128988-1129010 CTCACATGGAGGAAGGAGAAGGG - Intergenic
1050189573 9:3010541-3010563 ATCACAGAGAGGAAGGAGCTTGG + Intergenic
1050237988 9:3603135-3603157 TGCAGGAAGAGGAAGGAGAATGG - Intergenic
1052657646 9:31383338-31383360 GTCATGAACAGGACGGAGCAAGG - Intergenic
1053288150 9:36863057-36863079 CTCAAGAGAAGGAAGGAACAAGG + Intronic
1055133647 9:72804770-72804792 CTCACCAATATGAAGAAGCATGG + Intronic
1055343463 9:75309451-75309473 CTCATGAAGAGGAATGAAAATGG - Intergenic
1055964419 9:81851580-81851602 CTCACTATGCTGAAGGAGCAGGG + Intergenic
1056655217 9:88503376-88503398 CTCAGGCAGAGGAAGGAGAGGGG + Intergenic
1057010584 9:91597971-91597993 CTCACATAGGGGAAGGGGCAAGG - Intronic
1057936923 9:99248128-99248150 TTCAGGGAGAGGAAGGAACATGG - Intergenic
1058078600 9:100676595-100676617 CTCACGTGGTGGAAGGGGCAAGG + Intergenic
1059399967 9:114062714-114062736 CCCAAGAAGAGGAAGGATCAGGG - Exonic
1059554606 9:115266829-115266851 CTCAAGAGGAGGTAGGAGCCAGG - Intronic
1060756250 9:126216101-126216123 CCCAGGAAGAGGTAGGAGCTTGG - Intergenic
1061030827 9:128081566-128081588 TGCACCAAGAGTAAGGAGCAGGG - Intronic
1061282992 9:129608079-129608101 CGCACAAGGAGGAAGGGGCAAGG + Intergenic
1061368619 9:130185605-130185627 CCTACAAAGAGGCAGGAGCAGGG - Intronic
1185938509 X:4286001-4286023 CTCACATGGAGGAAGGGGCAAGG - Intergenic
1185962721 X:4563353-4563375 CTCACACAGTGGAAGGGGCAAGG + Intergenic
1186842264 X:13495733-13495755 CCCAGGAAGAGGCAGGAACACGG + Intergenic
1189068372 X:37836353-37836375 CTCACAAGGTGGAAGGAGCAAGG - Intronic
1189074158 X:37898165-37898187 CTCACGTGGGGGAAGGGGCAAGG + Intronic
1189504147 X:41594307-41594329 CTCCCGAACAAGAAGGAGAAGGG - Intronic
1189995439 X:46633003-46633025 CTCAGAATGAGGAAGGTGCAAGG - Intronic
1190242422 X:48667843-48667865 CTCACATAGTGGAAGGGGCAAGG + Intergenic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1192759265 X:74078311-74078333 CCCAGGAAGTGCAAGGAGCAGGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196895261 X:120329864-120329886 ATTACCAAGAGGAAGCAGCAGGG - Intergenic
1197057225 X:122135536-122135558 CTCACTCAGAAAAAGGAGCAAGG - Intergenic
1197289767 X:124641088-124641110 CTCATGAAGAGGAAAAGGCATGG + Intronic
1199853038 X:151738896-151738918 CACAGGAAGGGGAAGCAGCAGGG - Intronic
1199893484 X:152111086-152111108 ATCACAAAGTGGAAGTAGCATGG - Intergenic
1201451651 Y:14121919-14121941 CTCACAGGGTGGAAGGAGCAAGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201721854 Y:17107204-17107226 CTCACATGGAGGAAGAAGCAAGG - Intergenic