ID: 1171492584

View in Genome Browser
Species Human (GRCh38)
Location 20:25531867-25531889
Sequence CAGCTGGGGGTGCCTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171492574_1171492584 7 Left 1171492574 20:25531837-25531859 CCCGGCTGTGGGCAAGTCCTGCA 0: 1
1: 0
2: 3
3: 32
4: 232
Right 1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG 0: 1
1: 0
2: 8
3: 58
4: 480
1171492575_1171492584 6 Left 1171492575 20:25531838-25531860 CCGGCTGTGGGCAAGTCCTGCAC 0: 1
1: 0
2: 1
3: 24
4: 182
Right 1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG 0: 1
1: 0
2: 8
3: 58
4: 480
1171492579_1171492584 -10 Left 1171492579 20:25531854-25531876 CCTGCACCTAAGCCAGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG 0: 1
1: 0
2: 8
3: 58
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171492584 Original CRISPR CAGCTGGGGGTGCCTGGCCT TGG Intronic
900314947 1:2051801-2051823 CATCTGGGGCTGCTTGGCCCCGG + Intronic
900431056 1:2603413-2603435 CACAGGGCGGTGCCTGGCCTGGG + Intronic
900624970 1:3603834-3603856 CATCTGGGGGCGGCTGGCCTGGG - Intronic
900978170 1:6030254-6030276 AAGCTGGGGTTGCCTGGTCCAGG + Intronic
901060166 1:6468181-6468203 CAGCTGGAGGAGGCTGGCCTCGG + Exonic
901198696 1:7454585-7454607 GAGGTCGGGGTGCCTGGCCTTGG - Intronic
901274872 1:7983486-7983508 AAGCTGGTGGTGCCTGCACTAGG - Intronic
901676935 1:10890829-10890851 CAGGAGTGTGTGCCTGGCCTGGG - Intergenic
901838777 1:11940703-11940725 GAGCTCTGGGTGCCAGGCCTTGG + Intronic
902702485 1:18182023-18182045 CAAATGGGGGTGCCTGGCATAGG - Intronic
902835324 1:19043464-19043486 CAGATGGGGGTGCCTCATCTAGG + Intergenic
902987112 1:20161626-20161648 AAGCTGGGGGTGCCAGGATTGGG - Intronic
903368538 1:22819549-22819571 CAGCTGGGGTTGAGTGCCCTTGG - Intronic
904088599 1:27928834-27928856 CAGCTGGAGGCGCCTGTGCTGGG - Intergenic
904585694 1:31579472-31579494 CAGCCATGGGTGCCTGGCCCAGG + Intronic
904688147 1:32275168-32275190 CAGCTCGGGGTGGCCGCCCTTGG + Intronic
904745652 1:32709115-32709137 CAGCAGGGGAGGCATGGCCTTGG + Intergenic
904789846 1:33011274-33011296 CAGCTATGTGTGCCTGGTCTGGG - Intronic
905325403 1:37148252-37148274 GAGTTGAGGGTGCCTGGACTTGG - Intergenic
905896188 1:41547416-41547438 GGAATGGGGGTGCCTGGCCTGGG + Intronic
906666168 1:47623655-47623677 CAGCAGAGAGAGCCTGGCCTGGG + Intergenic
907309748 1:53532453-53532475 CAGCTGTGGGTGGCTCGCCTTGG - Intronic
907372927 1:54014570-54014592 CAGCTGTGGGCCCCTGGCCAGGG - Intronic
908510244 1:64845406-64845428 CAGCTAGAGGGGCCTGTCCTTGG - Intronic
909197709 1:72648580-72648602 CAGCTGGGTGTGCATGCGCTCGG + Intergenic
909235969 1:73152892-73152914 GAGCAGGGGGTCCCTGGGCTGGG + Intergenic
911451545 1:98068056-98068078 CAGCTAGGAGTAGCTGGCCTGGG + Intergenic
912517803 1:110226906-110226928 GAGCTAGGGATTCCTGGCCTCGG + Intronic
912713033 1:111963078-111963100 CAGCTGGGGATGGGTGGTCTAGG - Intronic
915562703 1:156696608-156696630 CAGCTGTGAGTGCCTAGCCTGGG + Intergenic
915594514 1:156888484-156888506 CACCGGTGGGTGGCTGGCCTGGG - Intergenic
915786937 1:158623867-158623889 CAGGTAGGGGTTCCTGGGCTGGG + Intronic
916576565 1:166072261-166072283 AGGCTGGGGCTGACTGGCCTAGG - Intronic
917188741 1:172390864-172390886 AAACTGGTGGTGCCTGTCCTGGG + Intronic
917796245 1:178534713-178534735 AAGCTGGGGTTGCCCTGCCTCGG + Intronic
918128851 1:181607541-181607563 GAGCTGGGCGTTCCTGGCCATGG + Intronic
919786071 1:201259550-201259572 GAGCTGGGGGAGGCTGGGCTTGG + Intergenic
920665908 1:207963015-207963037 GAGCTGGGGGTGCCAGGACAGGG + Intergenic
922315043 1:224434591-224434613 CAGCTCGGGGTGCGCGGCCCGGG + Intronic
922586419 1:226737577-226737599 CAGATGGGGCGGCATGGCCTGGG + Exonic
922746076 1:228044874-228044896 CGGATGGGGGTGTCTGTCCTGGG + Intronic
923365378 1:233255310-233255332 AAGCTGGAGGTGGCTGGACTAGG - Intronic
924710876 1:246529154-246529176 CAACTGAGGGTTCCTGGCCAAGG + Intergenic
1063830577 10:9947664-9947686 CAGCTGGAGGTGCCTTGCATAGG - Intergenic
1064451630 10:15447174-15447196 TAGCTGGGTGTGCCTGTACTGGG + Intergenic
1064513939 10:16125628-16125650 AAGCTGGAGTTGACTGGCCTTGG - Intergenic
1065245726 10:23755130-23755152 CAGCTGGGGGCAGCTGGGCTTGG - Intronic
1067035529 10:42913386-42913408 CAGCTGGAGGACCATGGCCTGGG + Intergenic
1067463366 10:46474899-46474921 CAGCTGGGGCTAGCTGACCTAGG + Intergenic
1067623828 10:47909739-47909761 CAGCTGGGGCTAGCTGACCTAGG - Intergenic
1067801198 10:49360742-49360764 GAGCTGCGGCTGCCTGGCCCTGG - Intergenic
1067823974 10:49556318-49556340 CAGCTGGGCCTGCATGGTCTAGG - Intergenic
1069032672 10:63614353-63614375 GATCTGGGGGTGACTGGACTTGG + Intronic
1069962715 10:72087911-72087933 GAGCTGGGGGTCCCGGGGCTGGG + Intronic
1070284385 10:75072654-75072676 CACCTGAGGGTCCCTGGCCCTGG - Intergenic
1070327901 10:75399998-75400020 GAGCTCGGGCTGCCTGTCCTGGG + Exonic
1070765539 10:79054073-79054095 GAGGCGGGGGTGCCTGGCCTTGG + Intergenic
1070966986 10:80535973-80535995 AACCTGGGTGTGCCTGGCCTGGG - Intergenic
1072543713 10:96417975-96417997 CAGGAGGGGCTGCCTGCCCTCGG + Intronic
1073076574 10:100828387-100828409 CAGCAGGAGGTGCCGGGCCCTGG - Exonic
1073327814 10:102652348-102652370 CAGCTGGGAGTGGCTGGGATGGG + Intronic
1073581273 10:104667854-104667876 GAGCTGGGGGTGCTTTGCCATGG + Intronic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075336016 10:121609291-121609313 CAGCTAGGACTGCCGGGCCTTGG - Intergenic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1075918477 10:126190082-126190104 CAGGTGGGGAAGCCTGGCCCCGG - Intronic
1076683257 10:132186087-132186109 CTGCTGGGGGTCCCGGGCCTGGG - Intergenic
1077240849 11:1509770-1509792 CGGCTGGGGGTGCCTGGCACTGG - Intergenic
1077298374 11:1836370-1836392 CAGCTGGGTGGGCCTGAGCTAGG + Intronic
1077303284 11:1856793-1856815 CTCCAGGTGGTGCCTGGCCTTGG - Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077882182 11:6359858-6359880 TAGTAGGAGGTGCCTGGCCTAGG - Intergenic
1079529055 11:21427043-21427065 CAGCTGGTGGTGCGTGGGCCTGG + Intronic
1080562779 11:33479200-33479222 GAGCTGGGGGTTCCTGGGCTAGG + Intergenic
1080964559 11:37199255-37199277 CAGCTAGGGGTGGCTGGTCTAGG + Intergenic
1081101443 11:39007185-39007207 CAGCAGGGGGTGCCTGGGCCTGG + Intergenic
1081315606 11:41625705-41625727 CAGCAGGGGGTCCCTGGACCTGG + Intergenic
1081992677 11:47346303-47346325 CAGATGGGGGTGCCTGCCGTAGG + Exonic
1083152152 11:60798635-60798657 CAGCTAGAACTGCCTGGCCTGGG + Intronic
1083456527 11:62782544-62782566 CTGCCAGGGGTGACTGGCCTAGG - Intronic
1083994623 11:66265942-66265964 TGGCTGGGGGTGCCGGGCCTCGG + Exonic
1084118170 11:67053959-67053981 CTGCTTGGGGTTCCTGGCTTGGG - Intergenic
1084547860 11:69823301-69823323 CAGCTGGAGGTGTCTGTCCCTGG - Intergenic
1084653065 11:70500267-70500289 CAGCTGGGGCTGCCTGGATGGGG - Intronic
1085119361 11:73957335-73957357 CCCCTCGGGGTTCCTGGCCTGGG + Intronic
1086437011 11:86791479-86791501 CAGCTAGAGGTGGCTGGCCCAGG - Intronic
1088754976 11:112878269-112878291 CTGTGGGGAGTGCCTGGCCTGGG - Intergenic
1089109143 11:116040901-116040923 CAGATGGGGTTGCCCTGCCTTGG - Intergenic
1089159179 11:116424470-116424492 CAGCTGGGGGACCTTGGTCTTGG - Intergenic
1089538226 11:119173659-119173681 CAGTGGGGGGAGCCCGGCCTGGG - Exonic
1089616797 11:119699428-119699450 GAGCTGGGTGTGGCCGGCCTGGG - Intronic
1089630478 11:119781189-119781211 CAGATGGGGCTGCCTGGTCTGGG + Intergenic
1089698619 11:120230854-120230876 GAGCTGGGCTTGCTTGGCCTTGG + Intergenic
1090347437 11:126082778-126082800 CGGCTGGGGCTGCCTGCCCTGGG - Intergenic
1090401512 11:126452490-126452512 CAGCTGTGGGTGCCGGGCTGGGG + Intronic
1090438049 11:126703111-126703133 CAGGTGGGGGTGGCTGGGCTGGG + Intronic
1090504604 11:127297954-127297976 CAGCAGGGGGTTCCTGGGCTTGG - Intergenic
1091912954 12:4246409-4246431 CAGCTCTGGGGGCCTCGCCTTGG - Intergenic
1092526400 12:9312625-9312647 TCCCTGGGGGTGCCTGGCCGGGG - Intergenic
1094512171 12:31103325-31103347 TCCCTGGGGGTGCCTGGCCGGGG - Exonic
1094830150 12:34296437-34296459 GAGAAGGGGGGGCCTGGCCTGGG + Intergenic
1095622635 12:44276479-44276501 CAGCTGGGGGTGAGGGGACTGGG + Intronic
1095633332 12:44402852-44402874 AAGCTCTGGGTGCCTGGACTTGG - Intergenic
1096501558 12:52067029-52067051 CAGGTGTGGGTGCCTCTCCTGGG - Intergenic
1096579546 12:52575579-52575601 AACCTGGGGGTGACTGTCCTAGG + Intergenic
1097233579 12:57526006-57526028 AAGCTGAGGGTGCCTGGGCACGG - Exonic
1101751971 12:107589382-107589404 CAGCTGGGGCTGTCTGGCTTGGG + Intronic
1101805421 12:108059436-108059458 CAGCTGGGGCTGGCTGATCTAGG + Intergenic
1102668913 12:114600782-114600804 CAGCTGTGGGGCCCTGGACTTGG - Intergenic
1103264549 12:119618014-119618036 CAGCAGGGGGTCCCTGGGCCTGG - Intronic
1103919791 12:124393347-124393369 CGGCTGTGGCTGCCTGCCCTGGG - Intronic
1103943995 12:124516306-124516328 CTGTGGGGGGTGCCTGGCCCAGG + Intronic
1104405599 12:128513899-128513921 AGGCTGGGGCTGCCTGTCCTTGG - Intronic
1104924238 12:132305817-132305839 CAGATGTGAGTGCCAGGCCTGGG + Intronic
1104949633 12:132433649-132433671 CAGCCGAGGATGCCTGTCCTTGG + Intergenic
1105356398 13:19663699-19663721 CAGTTGTGGGTTCCTGGCCCAGG + Intronic
1107840369 13:44451105-44451127 CACCTTAGGGTGCCTGGCATTGG - Intronic
1107870085 13:44738483-44738505 CAGCTGTGGCTGCCTTGCCTTGG - Intergenic
1109062483 13:57634780-57634802 CAGCTGCGGGTGGCTGTACTCGG - Exonic
1109496375 13:63177888-63177910 CAGCTCGGGGACCCTGGGCTGGG - Intergenic
1113660624 13:112104589-112104611 GAGCTGGGTGTCCATGGCCTGGG - Intergenic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1114069258 14:19095010-19095032 CAGCTGGGCTTGCCTGAGCTGGG + Intergenic
1114093003 14:19304992-19305014 CAGCTGGGCTTGCCTGAGCTGGG - Intergenic
1114655014 14:24310758-24310780 CTGCTGGGGCTGCCTGGCAACGG + Exonic
1116012310 14:39366224-39366246 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1117378619 14:55138161-55138183 CCCCTGGGGGTGCCTGCCCGGGG - Exonic
1118726934 14:68635239-68635261 AAGTTGGGGGTGCATGGCATGGG - Intronic
1119650931 14:76382295-76382317 CAGCAGGGGCTGCCGTGCCTTGG + Intronic
1121124238 14:91395695-91395717 CAGCTGGGCAATCCTGGCCTGGG - Intronic
1121258524 14:92549455-92549477 CAGCTTGGGGTGTGTGGCCCTGG - Intronic
1122307294 14:100773875-100773897 CAGTTTGGGGGGCCTGGCCCAGG + Intergenic
1122399514 14:101458573-101458595 GGGCTGGGGGTGCCAGGCTTTGG + Intergenic
1123016356 14:105377394-105377416 TGGCTGGGGTGGCCTGGCCTGGG + Intronic
1123063041 14:105602884-105602906 CAGCTGGGCTGGCCTGGCCTCGG - Intergenic
1202904255 14_GL000194v1_random:59480-59502 CCCCTGAGGGGGCCTGGCCTGGG - Intergenic
1123705970 15:22951425-22951447 CAGCATGGGGGGCCTGCCCTTGG + Intronic
1124587719 15:31024967-31024989 CAACTGTGGGTCCCTGGCCTCGG - Intronic
1125518190 15:40334588-40334610 CAGCTGGCAGGGTCTGGCCTGGG - Exonic
1126100275 15:45114536-45114558 AAGCTGGGGCTGCCTGGACGCGG - Exonic
1126666083 15:51077452-51077474 CAGCAGGGCGTGCTTGGCTTAGG - Intronic
1126666099 15:51077505-51077527 CAGGTGGGGGTTCCTTGACTAGG - Intronic
1127186444 15:56485631-56485653 GAGCAGGGGGTGCCTGGGCCCGG - Intergenic
1128226125 15:66002451-66002473 CTACTGTGGGGGCCTGGCCTGGG + Intronic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128495565 15:68196579-68196601 AAGGTCGGGGTCCCTGGCCTCGG + Intronic
1128559974 15:68658340-68658362 CAGCTGGGTGAGCCTGGCTGGGG + Intronic
1128995081 15:72289572-72289594 CAGGTGGGTGGGCCAGGCCTGGG - Intronic
1129398452 15:75266112-75266134 CTGCTGGGGGTGCCAGGGATGGG - Exonic
1129402060 15:75290388-75290410 CTGCTGGGGGTGCCAGGGATGGG - Exonic
1129475595 15:75782827-75782849 CTGCTGGGGGTGCCGGGGATGGG - Intergenic
1129660669 15:77551153-77551175 CAGCTGGGGCTGCTGTGCCTGGG + Intergenic
1129887554 15:79049193-79049215 CAGCTGAGAGTCCCAGGCCTGGG + Intronic
1130335172 15:82952317-82952339 CAGCAGGGGCACCCTGGCCTGGG - Intronic
1132355351 15:101167760-101167782 AAGCTGGGTGTGCATGGGCTTGG + Intergenic
1132501722 16:287398-287420 CTGCGGGTGGGGCCTGGCCTAGG - Intergenic
1132522466 16:397828-397850 CAGCTGGGGGGGCCGGGCAGCGG - Intronic
1132621759 16:871128-871150 CAGCTGGGGGCCCCTGCCCAAGG - Intronic
1132684081 16:1154949-1154971 CAGCTGGGGTGGCCAGGCCGTGG + Intronic
1132730152 16:1357073-1357095 CAGCCTGGGGTGCTTGGGCTTGG - Intronic
1133001140 16:2852327-2852349 CAGAAGGGGGGGCTTGGCCTGGG + Intergenic
1133071057 16:3246996-3247018 CAGGTGGGTGTGCCTGGGCCCGG - Exonic
1133393823 16:5430251-5430273 CAGGTGGTGGGGCCTGACCTGGG + Intergenic
1134073634 16:11275873-11275895 CAGCTGGGGGTGAGGGGCCCAGG + Exonic
1134633391 16:15773574-15773596 TAGCTGGGGGTGGCTGGGCACGG - Intronic
1135158749 16:20075035-20075057 CTCCTGGGGATGCCTGGCCTGGG - Intergenic
1135393330 16:22112131-22112153 TAGCTGGGGGTTTCTAGCCTGGG + Intronic
1135435553 16:22424698-22424720 GAGCTGGGGGTGCCAGCACTTGG - Intronic
1136068983 16:27776848-27776870 GGGCTGGGGGTGCCAGGCGTGGG - Intronic
1136284092 16:29231145-29231167 CAGCTGCTGGTCCCTGGTCTGGG - Intergenic
1137604864 16:49780639-49780661 CAGCCCGGGCTGCCTGGCCAGGG + Intronic
1138209702 16:55153087-55153109 CCGCTAGGGCTGCCTGGCCCTGG - Intergenic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1138415834 16:56870783-56870805 AAGCGGGGGTTGCCAGGCCTGGG + Intronic
1138580914 16:57939993-57940015 CTCCTGTGGGTGCCTGGCTTGGG - Intronic
1139348546 16:66320742-66320764 CAGCTGTTGGTGCCTGTGCTGGG - Intergenic
1139433733 16:66924872-66924894 CTGCTGGGGGCGCCCGGCGTGGG - Exonic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1140504274 16:75460647-75460669 CAGCTGGTGGTGAGGGGCCTGGG - Intronic
1140506019 16:75473323-75473345 CAGCTGGAGCTGGCTGGTCTAGG + Exonic
1141177518 16:81730610-81730632 CAGCTGCGGGAGCCCGGGCTGGG + Intergenic
1142044757 16:87918503-87918525 GAGCTGGGGGTGCCAGCACTTGG - Intronic
1142044904 16:87919230-87919252 CAGCTCGGGGTCCATGGCCAGGG + Intronic
1142089124 16:88200653-88200675 CAGCTGCTGGTCCCTGGTCTGGG - Intergenic
1142149360 16:88505907-88505929 GTGCGGGGGGTGCCTGTCCTTGG - Intronic
1142361698 16:89630622-89630644 GGGCTGGGGGTGCCGGGGCTGGG + Intronic
1142361706 16:89630637-89630659 GGGCTGGGGGTGCCGGGGCTGGG + Intronic
1142361730 16:89630682-89630704 GGGCTGGGGGTGCCGGGGCTGGG + Intronic
1142361746 16:89630712-89630734 GGGCTGGGGGTGCCGGGGCTGGG + Intronic
1142361754 16:89630727-89630749 GGGCTGGGGGTGCCGGGGCTGGG + Intronic
1142592124 17:1010878-1010900 CAGCTAAGGCTGCCTGACCTCGG - Intronic
1142743388 17:1943045-1943067 CAGCTGTGGCTGGCCGGCCTGGG - Intronic
1142769672 17:2087589-2087611 GAGCTTGGGGTGCCTGGTCCTGG + Intronic
1143303816 17:5930277-5930299 CATCTTGGGGTGCGTGCCCTTGG + Intronic
1143512976 17:7405934-7405956 CGGCTGGGGGAGTCAGGCCTGGG + Intronic
1145061597 17:19737571-19737593 GTGCTGGTGCTGCCTGGCCTCGG + Intergenic
1145909585 17:28534801-28534823 CAGCTGGGGGTGCCAGGGGCCGG - Exonic
1146339483 17:32007269-32007291 GAGCTCGGGGCGCCTGGACTTGG - Intergenic
1146532435 17:33620862-33620884 GGGCTGGGGGTGCATGGTCTGGG - Intronic
1147156346 17:38546284-38546306 TAGCTGTGGGTGGGTGGCCTTGG - Intronic
1147161550 17:38572037-38572059 CTGCTGGGGATGCCTGCCCAGGG - Intronic
1147214236 17:38890215-38890237 CAGCTGGGACTGGCTGACCTGGG - Intronic
1147339285 17:39744310-39744332 AAACTGGAGGTGGCTGGCCTGGG - Intronic
1147674088 17:42192972-42192994 CTGCTGGGTCTGGCTGGCCTTGG + Exonic
1147732925 17:42615046-42615068 CAGATGAGGGTCCCTGTCCTGGG - Exonic
1147992979 17:44346220-44346242 CAGCTGCAGGTGCTTTGCCTGGG + Intronic
1148050256 17:44766625-44766647 CACCTGGAGGTGACTGGCCCAGG - Intronic
1148784099 17:50136890-50136912 CAGCTGCGGGGGCCTGGTCTGGG - Intronic
1149238869 17:54625039-54625061 CAGCTGGGTGTTTCTGGCTTGGG - Intergenic
1149293343 17:55238355-55238377 CAGCTAGGGGCTCCTGGCCCGGG - Intergenic
1150439732 17:65181514-65181536 CAGCTGGGAGGGACTGGCCAGGG + Intronic
1151315067 17:73316879-73316901 CAGCTGGGGTGGCCTGGCGCTGG + Intergenic
1151666146 17:75546173-75546195 TAGGTGGTGGTGCCAGGCCTTGG + Intronic
1151805925 17:76405377-76405399 GCGCTGGGGTTGCCTGGGCTGGG - Intronic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1151956595 17:77383221-77383243 CAGCTGGAAGGGCCTGGACTTGG - Intronic
1152621506 17:81367190-81367212 CAGTTGGGGAAGCCTGGGCTTGG - Intergenic
1153479279 18:5530752-5530774 CAGCTGTGGGTGTGTGGCTTTGG - Intronic
1156457075 18:37300845-37300867 CATCTGGGGGTGCCTGGCAGAGG + Intronic
1157570839 18:48711083-48711105 TCACTGGGGGTGCCTGGACTAGG + Intronic
1157580868 18:48773494-48773516 GAGCTGGGGTTGCCTGCCATGGG + Intronic
1157666797 18:49493981-49494003 CAGCTGGGAGTGGCAGCCCTGGG + Intergenic
1158890587 18:61868350-61868372 CAGCTGGGGGTGGCTGGGCTGGG - Intronic
1160408914 18:78661507-78661529 CAGGGGCGGGTGCCTGACCTGGG - Intergenic
1160451014 18:78966068-78966090 CCTCCAGGGGTGCCTGGCCTGGG - Intergenic
1160488189 18:79312462-79312484 CAGCTGGGGACCCCTGGTCTGGG - Intronic
1160679448 19:406097-406119 CAGCTGGGGGGACCTGGCTATGG - Exonic
1161377276 19:3946425-3946447 CACCCGGGGCTGCCTGGTCTCGG - Intergenic
1161405884 19:4090888-4090910 CAGCGGCGTGTGCCAGGCCTGGG + Intronic
1161485194 19:4531724-4531746 CAGCAGCGGGTGCCTGTCCTTGG + Exonic
1161609121 19:5231275-5231297 CTGCGGGGGGTCCCGGGCCTGGG + Intronic
1161743037 19:6036229-6036251 CTGCTGGGGCTGCCTGGCCTGGG + Intronic
1161768832 19:6220687-6220709 CGCCTGGAGATGCCTGGCCTGGG + Intronic
1162110036 19:8395091-8395113 CAGCTACGGGAGCCTGGCCAAGG - Intronic
1162957444 19:14107155-14107177 GGGATGGGGGTGCCTGGCATTGG + Intronic
1163218563 19:15897998-15898020 AGGCTGGGGGTGGCAGGCCTGGG - Intronic
1163283314 19:16330638-16330660 CACCTGGGGCTGCCGGGCGTGGG - Intergenic
1163692953 19:18746967-18746989 CAGCCGGGGCTTCCTGCCCTGGG + Intronic
1163714638 19:18866675-18866697 CAGCAGGGGGCGCTCGGCCTCGG - Exonic
1164156401 19:22600175-22600197 TTGCTGGGGGTGCCAGGGCTGGG - Intergenic
1164734349 19:30529876-30529898 CAGATGTGGGTGCCTTGCATGGG - Intronic
1165063859 19:33218084-33218106 CAGCGGGGGCTGGGTGGCCTTGG + Intronic
1165108191 19:33486713-33486735 CTACTCGGGGTGCCTGGCCTGGG - Intronic
1166003062 19:39889727-39889749 CAGCTTGGGCTGCGTGGCCGTGG - Exonic
1166005849 19:39905979-39906001 CAGCTTGGGCTGCGTGGCCGTGG - Exonic
1166863801 19:45824255-45824277 CAGCAGGTGGAGCCTGGTCTGGG - Intronic
1166919902 19:46222089-46222111 CAGCTGGCCGTCCTTGGCCTTGG - Intergenic
1167484964 19:49757335-49757357 CAGCTGGGTGGGCCTGGCTCAGG - Intronic
1167509402 19:49888283-49888305 TAGCTGGCGGTGCAGGGCCTCGG - Exonic
1167714096 19:51129926-51129948 AAGCTGGGGGAGGCTGGTCTGGG - Intronic
1168314045 19:55476405-55476427 GAGCTGGCCGTCCCTGGCCTTGG + Exonic
1168703895 19:58457244-58457266 CAGGTGTGAGGGCCTGGCCTGGG + Exonic
925045993 2:773614-773636 TAGGTGGGGGCGCCAGGCCTGGG - Intergenic
925290252 2:2743334-2743356 GAGCTGGAGCTGGCTGGCCTAGG + Intergenic
925390355 2:3490124-3490146 TGCCTGGGGGTGCCTGCCCTGGG - Intergenic
925898834 2:8494291-8494313 CAGCTGGTGGTGCCTTGTCATGG - Intergenic
926118270 2:10226798-10226820 CAGCTGGAAGGGCCTAGCCTGGG + Intergenic
926162544 2:10499098-10499120 TAGCTAGGGGTGTCTGGCCAGGG - Intergenic
926325223 2:11779413-11779435 CAGCTGGGGGTGCATTTTCTGGG + Intronic
927460964 2:23297894-23297916 CAGCTGGGGGTGCCTGGTGGTGG - Intergenic
927471920 2:23384031-23384053 CAGCTGGGAGGAGCTGGCCTGGG - Intergenic
927853530 2:26514246-26514268 AGGGTGGGGGTGCCTGGCTTCGG + Intronic
928196905 2:29222663-29222685 CAGCTGGGGGTCCTGAGCCTGGG + Intronic
928429566 2:31206237-31206259 CAGCTGGGGGCTCCTGGGATGGG - Intronic
928941363 2:36730586-36730608 CAGCCGGTGGTGCCTCACCTGGG + Intronic
929393099 2:41494304-41494326 CAACTGAGGGTTCCTGGCCAGGG + Intergenic
929957716 2:46471419-46471441 CAACTGGGGGAGCTTGGCCGAGG - Intronic
931430839 2:62207821-62207843 CCGCTAGGGGTCCATGGCCTGGG + Intronic
931764620 2:65443971-65443993 CAGCAGCGGGTGCCTGGGCTTGG + Intergenic
932137863 2:69246249-69246271 CAGCTAGAGGTGGCTGGCTTTGG + Exonic
932593523 2:73080727-73080749 CAGCTGATGATGCCTGGCCTTGG - Intronic
933658043 2:84905467-84905489 GAGCTGGGGGTGCCCGGCGCGGG + Intronic
933726221 2:85429253-85429275 CAGCTGGGGGAGGCCCGCCTAGG + Intronic
933832010 2:86218693-86218715 CTGCTGGAGGAGTCTGGCCTGGG - Intronic
934542697 2:95189197-95189219 CAGCTGGGAGTGCAGGGGCTGGG - Intergenic
934571273 2:95374709-95374731 CTGCTGGGGCCCCCTGGCCTGGG - Intronic
934571371 2:95375060-95375082 CAGCTGGGGTTGCCTGGGGTGGG + Intronic
934692504 2:96372380-96372402 CAGTTGGGGGTGCCTGGAGGAGG + Intronic
934867003 2:97822752-97822774 CTGTTGTGGGTGCCTGGGCTGGG + Intronic
935239022 2:101162145-101162167 CAGAGAGGAGTGCCTGGCCTGGG - Intronic
937126009 2:119475428-119475450 CAGCTCTGGGCACCTGGCCTGGG - Intronic
937828983 2:126399603-126399625 TAGCTGGGGGTGGGTAGCCTAGG - Intergenic
938025744 2:127946356-127946378 CAGCTGGGGGAGCCTTTCCAAGG + Intronic
938201048 2:129373356-129373378 CAGCTGAGGGTGCCAAGCATTGG + Intergenic
938277351 2:130038055-130038077 CGACTGGGGGTGCCAGGCCCAGG - Intergenic
938328324 2:130428858-130428880 CGACTGGGGGTGCCAGGCCCAGG - Intergenic
938361623 2:130692636-130692658 CGACTGGGGGTGCCAGGCCCAGG + Intergenic
938438033 2:131299325-131299347 CGACTGGGGGTGCCAGGCCCAGG + Intronic
938548165 2:132353413-132353435 CAGGTGGTGGAGCATGGCCTGGG - Intergenic
942767102 2:179469890-179469912 CAGCTGTGGGTGACTGGATTAGG + Intronic
944502665 2:200378145-200378167 CAGCAGGGGGTTGGTGGCCTTGG - Intronic
945898529 2:215512657-215512679 TAGCTGGGCGTGCCTGTGCTGGG - Intergenic
946238652 2:218340824-218340846 CAGCTGGGCTTGCCAGGACTGGG + Intronic
946404030 2:219483445-219483467 CAGCTGCGGGCTCCTGGCCTGGG - Exonic
946689806 2:222301543-222301565 TGGCTGAGGCTGCCTGGCCTAGG + Intronic
947578091 2:231292813-231292835 CACCTGGGGGCTTCTGGCCTTGG - Intronic
947914526 2:233822825-233822847 CTGCTGGGAGCGCATGGCCTGGG - Intronic
948072335 2:235138022-235138044 TAGCTGTGGATACCTGGCCTGGG - Intergenic
948078881 2:235189349-235189371 CAGCTGTGGATACCTAGCCTTGG - Intergenic
948140820 2:235670627-235670649 CAGCTCCGGGAGCCTGGCCTGGG + Intronic
948148777 2:235728571-235728593 GAGCTGCTGGTGCCTGCCCTGGG + Intronic
948460184 2:238125363-238125385 CGGCTGGGGTTCCCTGGCCCTGG - Exonic
948476641 2:238224980-238225002 AAACAGGGGGTGCCTGGCCCAGG + Intronic
948642874 2:239386452-239386474 CAGCTGAGGGTGCAGGTCCTGGG + Intronic
948808537 2:240463290-240463312 GCCCTGGGGGTGCCTGGCCCCGG - Intronic
1169193460 20:3671618-3671640 CAGCTGGACCTGCTTGGCCTGGG - Exonic
1169660841 20:7976554-7976576 CTGCCTGGGATGCCTGGCCTGGG + Intergenic
1170240772 20:14164343-14164365 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1171273268 20:23833080-23833102 CAGCTGGGAGTCACTGACCTGGG + Intergenic
1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG + Intronic
1171877036 20:30586185-30586207 CAGGTGGTGGAGCATGGCCTGGG - Intergenic
1172098773 20:32473532-32473554 CAGCTGGAGGTGTCTGGGCCAGG - Intronic
1173211884 20:41040558-41040580 CAGTGTGGGGTGCCTGGCCCTGG - Intronic
1173228147 20:41174019-41174041 CAGCAGGGGTGGGCTGGCCTGGG + Intronic
1173249556 20:41357443-41357465 CAACTGTGAGTGCCTGGGCTGGG + Exonic
1173563054 20:44020012-44020034 CAGCTGATGCTGCCTGACCTTGG - Intronic
1173864487 20:46305580-46305602 CAGCTGGCACTGCATGGCCTGGG - Intronic
1174174414 20:48635980-48636002 CTGGTGGGGAGGCCTGGCCTTGG - Intronic
1174558293 20:51412269-51412291 CAGCTGGGGGTGATTGGACTGGG + Intronic
1174806594 20:53608786-53608808 CCGCTGGGAGAGCCGGGCCTTGG + Intronic
1175191515 20:57215111-57215133 CAGCTGGGTGCCCATGGCCTGGG - Intronic
1175396012 20:58662234-58662256 CATCTGGGAGTGCCTGGGCCGGG + Intronic
1175523575 20:59618476-59618498 CAGATGGTGGGGCCTGGGCTGGG + Intronic
1175652262 20:60735757-60735779 GAGCTGGGAGGGCCTAGCCTGGG + Intergenic
1175915487 20:62423967-62423989 CAGCTAGGGGTGCTGGGGCTGGG + Intronic
1176082006 20:63278216-63278238 GAGCTGGGGACGCCTGGCGTGGG + Intronic
1176138869 20:63536553-63536575 CAGCTGGTGTGGCCTGGCCCTGG - Intronic
1176150649 20:63589082-63589104 CAGCTTGGGCTGCTTGGCCACGG - Exonic
1176172705 20:63703400-63703422 GGGGTGGGGGGGCCTGGCCTTGG - Intronic
1176623626 21:9074247-9074269 CCCCTGAGGGGGCCTGGCCTGGG - Intergenic
1177761011 21:25402254-25402276 CAGCAGGGGGACCCTGGGCTCGG - Intergenic
1177849863 21:26333380-26333402 CAGCTTGTGCTGCCAGGCCTGGG - Intergenic
1178924999 21:36767374-36767396 CATCTGGGGGTGTGTGGCCATGG + Intronic
1179413494 21:41179736-41179758 AAGCTGAGGGTGCCTGGTGTGGG + Intronic
1179530623 21:42016342-42016364 GAGATGGTGGTGCCAGGCCTTGG + Intergenic
1179881744 21:44295950-44295972 CTGCTGGGGGTGCCTGCCTGGGG + Intronic
1180086385 21:45509683-45509705 CTGCTGGGGGTCCCAGGCTTCGG + Intronic
1180091774 21:45537235-45537257 CAGATGGAGGGGCCTGGCTTCGG - Intronic
1180487729 22:15817573-15817595 CAGCTGGGCTTGCCTGAGCTGGG + Intergenic
1181027276 22:20133274-20133296 CAGCCTGGGGAGCCTGGCCTGGG + Intronic
1181534013 22:23532513-23532535 CAGCTGGGGCTGTGTGACCTTGG + Intergenic
1181672199 22:24430906-24430928 CTGCTGGTGGTGCTGGGCCTGGG + Intronic
1181749155 22:24976790-24976812 CAGGTTGGGGTGCTTGGGCTGGG + Intronic
1182585103 22:31340453-31340475 CAGCCAGGTGTGCCTGGACTTGG - Intronic
1182622465 22:31625617-31625639 AGGCTGGAGGAGCCTGGCCTGGG - Intronic
1182881702 22:33739246-33739268 CAGCCTGGGATGCCTGGCTTTGG + Intronic
1183417418 22:37690638-37690660 TAGCTGGGGGGACCTGGGCTGGG - Intronic
1183758951 22:39798636-39798658 AAGCTGAGGGTGCCTGTCCTTGG + Intronic
1184094993 22:42311625-42311647 CAGCTGGGAGGGCCAGGCCTGGG - Intronic
1184474753 22:44714426-44714448 GGGCTGGGGGTGCAGGGCCTCGG + Intronic
1184523878 22:45010106-45010128 CCGCTCGGGGTGCCGGGCCGCGG - Intergenic
1184597974 22:45525800-45525822 CAGCTGGGGGTTCCTGGGCCAGG + Intronic
1184682412 22:46079432-46079454 CAACTGGGGTTGGCAGGCCTGGG - Intronic
1184734488 22:46390184-46390206 CACGTGGGGGTGCCTGGCTCAGG + Intronic
1184803032 22:46774120-46774142 CTGCTGGGCCTGCCTGCCCTTGG + Intronic
1184885492 22:47342616-47342638 CAGCTGTAGGTTCCGGGCCTGGG + Intergenic
1185044902 22:48523915-48523937 CAGCTGTGGGCACCTCGCCTGGG - Intronic
1185158979 22:49211428-49211450 GAGCTGGAAGTGCCAGGCCTTGG - Intergenic
950021881 3:9793140-9793162 CAGCCGGGGGTCCCTGGCCGGGG - Exonic
950183551 3:10931519-10931541 CAGCGGGCCATGCCTGGCCTGGG - Intronic
950256465 3:11510606-11510628 CAGCTGGGAGAGGCTCGCCTTGG + Intronic
950726179 3:14918500-14918522 CACCTGGGGTTGCCCGGGCTGGG + Intronic
951475767 3:23104082-23104104 CAGCTGGGGCTGCCTGGGCTTGG - Intergenic
951584156 3:24198081-24198103 CAGGTGGCTTTGCCTGGCCTGGG + Intronic
953758307 3:45666472-45666494 CAGCTGGGGATTCCAGACCTCGG - Intronic
953829703 3:46285481-46285503 TAGCCGGATGTGCCTGGCCTGGG + Intergenic
953983887 3:47426867-47426889 CAGCTGGGGATGCCTGCCCTAGG + Intronic
954107576 3:48417715-48417737 CACCTGTAGGTTCCTGGCCTGGG - Intronic
954140836 3:48604498-48604520 CAGCAGGAGATGCCAGGCCTGGG - Intronic
954364842 3:50140231-50140253 CAGCCGGAGGTGCCTAGGCTAGG - Intergenic
954379528 3:50212311-50212333 CAGCTGGGGGTGCCCTCTCTCGG - Intronic
956836372 3:73099511-73099533 CAGCAGATGGTCCCTGGCCTAGG + Intergenic
957685688 3:83501756-83501778 CAGCTGTGGATGGCTTGCCTTGG - Intergenic
961466712 3:127086132-127086154 CAGATGGGCATGCTTGGCCTTGG + Intergenic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
961770971 3:129249744-129249766 CAGGTGAGGGGGCCAGGCCTGGG + Exonic
961829264 3:129615168-129615190 CTGCTGGGGGGGCATGTCCTGGG - Intergenic
962345363 3:134614793-134614815 CAGCTGTTGGGGCCTGGCCTTGG - Intronic
962634106 3:137312524-137312546 CATCTGAAGGTGGCTGGCCTGGG + Intergenic
962685897 3:137847480-137847502 CAGCAGGCTGTGCCTGCCCTGGG + Intergenic
963923371 3:150926333-150926355 GTGCAGGGGGTACCTGGCCTTGG + Intronic
967969647 3:194989459-194989481 CGGCTGGGCCTGCATGGCCTAGG + Intergenic
968540428 4:1165532-1165554 GAGCTGGGGGTCCCTGGGGTAGG - Intergenic
968545240 4:1194792-1194814 CAGCGGGGGCTGCCTGGCAGAGG + Intronic
968704662 4:2072331-2072353 TGGCTGGGGGTGGCTGGCCCAGG - Intronic
968818735 4:2834842-2834864 CAGCTGGGTGTGCAGGGACTGGG + Exonic
968890466 4:3366088-3366110 CATCTGGGGGGTGCTGGCCTGGG + Intronic
969262583 4:6043304-6043326 AAGCTGGGGGAGCCTGGGGTCGG - Intronic
969293061 4:6252876-6252898 CAGCTTGGTGTGCATGGCCAAGG - Intergenic
969370506 4:6728352-6728374 CAGCGGTGTGTGCCAGGCCTGGG - Intergenic
969429824 4:7147647-7147669 GAGCTGGGGGGCCCAGGCCTGGG - Intergenic
969605111 4:8198540-8198562 CTGCTGAGGAAGCCTGGCCTGGG - Intronic
969642783 4:8409275-8409297 CAGCTGAGAGGGCCTGGCCAAGG - Intronic
970977343 4:22057060-22057082 CAGCTCGGGGACCCTGGGCTCGG - Intergenic
971250561 4:24970282-24970304 CAGCTGTGGATGGCTGGCCTCGG + Intronic
972345366 4:38188386-38188408 CAGGTGTGGGTGGCTGGCCTGGG + Intergenic
974843360 4:67323226-67323248 CAGCAGGGGGGCCCTGGGCTTGG - Intergenic
975762288 4:77631919-77631941 CAGCTGTGGATGGCTTGCCTTGG - Intergenic
978131503 4:105203642-105203664 CAGAAGGGAGTGCCTGGCTTTGG + Intronic
978466243 4:109012576-109012598 CAGCCGGCGGTGCCAGCCCTGGG + Intronic
978515114 4:109560672-109560694 CGGCTGGGGGTGCCTCACCCGGG + Intronic
978663550 4:111155166-111155188 CAGCAGGGGAGGCCTGGCCAGGG - Intergenic
980655461 4:135777570-135777592 CAGCTGGGAGCTCCTAGCCTTGG + Intergenic
980738211 4:136917954-136917976 CAGCTGGGTGTGCATGCTCTTGG + Intergenic
981200420 4:141973129-141973151 CAGCAGGGGGTCCCTGGCCCTGG + Intergenic
983966379 4:173817361-173817383 CCGCTGGGGGTTACTGACCTTGG + Intergenic
985599547 5:819588-819610 CAGCCGGGAGTTCCTGGCCTTGG + Exonic
986273507 5:6253999-6254021 CACCTGCAGGTCCCTGGCCTTGG + Intergenic
987841154 5:23224179-23224201 TAGCTGGGGGTGACTGACCTGGG - Intergenic
988486426 5:31671682-31671704 AGGCCGCGGGTGCCTGGCCTTGG - Intronic
989647400 5:43650041-43650063 CTGCTGGGGATGCCTAGCTTTGG - Intronic
991409350 5:66331349-66331371 CAGCAGTGGGTGCCTGGGCCTGG - Intergenic
991489339 5:67166877-67166899 TAGCTGGGGGAGGCTGGGCTGGG - Exonic
991940845 5:71850545-71850567 CAGCAGGGGGACCCTGGACTTGG + Intergenic
993872355 5:93267799-93267821 CTGCTGCTGGTGTCTGGCCTGGG + Intergenic
994303151 5:98171204-98171226 CAGCAGGAGGTGAGTGGCCTGGG - Intergenic
995740455 5:115350468-115350490 CATCTGTGGGTGCCTCTCCTTGG - Intergenic
997473066 5:134127503-134127525 CAGAGGAGGGTGCCTGGCCCAGG - Intronic
997529800 5:134575000-134575022 CAACTGTGGGTGCCTTGCATGGG - Intronic
997990961 5:138543894-138543916 CAGCGGGGGCTGCCTGAGCTTGG + Intergenic
999266484 5:150270020-150270042 CAGCTAGAGGTGACTGGCCTGGG - Intronic
999331519 5:150676750-150676772 ATGAAGGGGGTGCCTGGCCTGGG - Exonic
999375899 5:151086317-151086339 CAGCTGTGTCTGCCTGCCCTTGG + Intronic
999941933 5:156552368-156552390 CAGTTGGCAGTGCCTGACCTAGG + Intronic
1000209613 5:159097627-159097649 CAACTGCGAGTGCCCGGCCTTGG + Intronic
1002435597 5:179229028-179229050 CAGCTGGAGGTGCCTGACCGAGG - Intronic
1002640251 5:180627304-180627326 CCGGGGGGAGTGCCTGGCCTGGG + Intronic
1003394475 6:5741464-5741486 CAGCTGGGGGAGCCTTTCCAGGG + Intronic
1006463861 6:34179342-34179364 CAGCTGGGTGTGCATGCACTTGG - Intergenic
1006509669 6:34515165-34515187 CAGCTGGAGGGGCCGGGCCAGGG + Intronic
1006811889 6:36825449-36825471 CAGTTGGGGGTGGCTGCCTTTGG - Intronic
1007096099 6:39214225-39214247 CGGCTGTGGGAGCCTGCCCTGGG + Intronic
1008086733 6:47253331-47253353 TAGCTGGGCGAGGCTGGCCTCGG + Exonic
1008242514 6:49129879-49129901 CAGCAGGGGGACCCTGGGCTTGG - Intergenic
1009501568 6:64420285-64420307 CAGCCGGGGGAGCCTGGGCCTGG + Intronic
1010399456 6:75431682-75431704 CAGCTGGCTGTGCCTGGTGTGGG - Intronic
1012431687 6:99170832-99170854 CATCTGGGGGTGGCTGTCCTTGG - Intergenic
1014553186 6:122812499-122812521 CTTCTGGTGGTGCCTAGCCTAGG + Intergenic
1015567200 6:134585867-134585889 CATCTGGGAGTGCAGGGCCTGGG + Intergenic
1018806684 6:167267343-167267365 TGGCTTTGGGTGCCTGGCCTGGG + Intergenic
1019179775 6:170178910-170178932 CAGCTGGGTGGCCCTGTCCTGGG - Intergenic
1019593226 7:1846170-1846192 CAGCAGGGGGAGACTGGCCCTGG - Intronic
1019596019 7:1858769-1858791 CAGCTGGGGGCCCCTTGCCCTGG - Intronic
1022471701 7:30685569-30685591 GAGGAGGGGGTGCCTGGCCTGGG - Intronic
1023812190 7:43920064-43920086 CAGATGAGGGTCCCTGTCCTAGG - Intronic
1023816111 7:43951249-43951271 CATGTGGTTGTGCCTGGCCTAGG - Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1025813732 7:64891003-64891025 CAGATGGCTGTGCTTGGCCTGGG + Intronic
1026466079 7:70655796-70655818 CAGCTGGGTGTGGCAGACCTGGG - Intronic
1026766061 7:73160583-73160605 CATCTGGGTGTGGCTGGACTAGG + Intergenic
1026898085 7:74022025-74022047 CAGCTGAGGGTTCCGGGCATGGG + Intergenic
1027042536 7:74970279-74970301 CATCTGGGTGTGGCTGGACTAGG + Intronic
1027081107 7:75232078-75232100 CATCTGGGTGTGGCTGGACTAGG - Intergenic
1027432924 7:78132946-78132968 CTGTTGGGGGTGGCTGGGCTTGG + Exonic
1029527435 7:101103626-101103648 AGGCAGGGGGTGCCAGGCCTGGG - Intergenic
1032190431 7:129762470-129762492 GAGCTGAGGGTCCCTGGCCCAGG + Intergenic
1033118587 7:138647509-138647531 CAGCTAGGGGTGCCTGGAGATGG + Intronic
1034282078 7:149861577-149861599 CCTCTGGAGGTGCCTGGCCAGGG - Exonic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1035051219 7:155999932-155999954 CAGGTGAGGCTGCCTGGGCTGGG + Intergenic
1035056535 7:156039939-156039961 CAGCCGGGTGTCCCAGGCCTCGG + Intergenic
1035297491 7:157875713-157875735 CCCCTGGGGATGCCTGACCTGGG - Intronic
1035297515 7:157875772-157875794 ACCCTGGGGATGCCTGGCCTGGG - Intronic
1035297562 7:157875892-157875914 ACCCTGGGGATGCCTGGCCTTGG - Intronic
1035297585 7:157875952-157875974 GCCCTGGGGATGCCTGGCCTGGG - Intronic
1035450023 7:158971386-158971408 CAGCTGGGGATGGCTGGTCAGGG - Intergenic
1035458466 7:159024414-159024436 CAGCTCGGGGTGCCTGGCGGCGG - Intergenic
1035472217 7:159117700-159117722 CAGCTGAGGGTGGGTGGCCCAGG + Intronic
1035630182 8:1101506-1101528 CAGACGGGGGTGCCGGGGCTGGG + Intergenic
1037315048 8:17592707-17592729 TAGCTGGGGGGGCCTGCCATGGG - Intronic
1037360471 8:18068714-18068736 CAGCTCAGGATGCCCGGCCTGGG - Intronic
1037456873 8:19072609-19072631 CAGCTGGGAGCCCGTGGCCTGGG - Intronic
1039886026 8:41654261-41654283 CAGCTGGCAGTTCCTCGCCTCGG - Intronic
1041281216 8:56212043-56212065 GAGCTGGGGTTGCCCGGACTAGG - Intronic
1042439728 8:68811215-68811237 CAGCTGGGTGTGCATGCACTTGG - Intronic
1043397608 8:79854125-79854147 CAGGTGTGAGAGCCTGGCCTGGG - Intergenic
1045510704 8:102810414-102810436 CAGCAGGGAGAGCCCGGCCTGGG - Intergenic
1047253757 8:123200433-123200455 CAGCTGGGGGGCCCTCGCCCTGG + Intronic
1047784494 8:128140758-128140780 CTGCTGGGGATGGCTGGACTCGG + Intergenic
1048238408 8:132715994-132716016 CAGCAGGGGAGGCCTGGCCAGGG + Intronic
1049101714 8:140584341-140584363 CTGGTGGGGGTGGGTGGCCTTGG + Intronic
1049208197 8:141373085-141373107 CAGTTTGTGGTGGCTGGCCTGGG - Intergenic
1049235500 8:141510417-141510439 CAGCTTGGGGACCCGGGCCTGGG - Intergenic
1049402797 8:142437829-142437851 GAGGTGAGGCTGCCTGGCCTAGG - Intergenic
1049514267 8:143045157-143045179 CTGCTGGGGGTGGCGGGCTTCGG - Intronic
1049664796 8:143838153-143838175 GAGATGGGGGTGCCTGGTCGGGG - Intronic
1049693101 8:143971357-143971379 CAGCTGCGGGCCCCTGTCCTGGG - Intronic
1051265698 9:15306928-15306950 CGGGTGGGGGCGCCCGGCCTTGG - Intronic
1052423382 9:28272865-28272887 AAGATGGGGGTACCTGTCCTTGG - Intronic
1052466865 9:28839998-28840020 CAGTTGGGTGTGCCTGCACTTGG - Intergenic
1052872693 9:33523835-33523857 CAGGTGGTGGAGCATGGCCTGGG - Intergenic
1055990642 9:82102135-82102157 CAGCTCGGGGAGCCTGAGCTAGG - Intergenic
1056655281 9:88503731-88503753 CAGCTGCGGCTGCCTGGCCCAGG - Intergenic
1057684757 9:97221990-97222012 CAGGTGGTGGAGCATGGCCTGGG + Intergenic
1058971127 9:110083994-110084016 CAGCTGGGAGTTCCCGCCCTAGG - Intronic
1059450961 9:114371192-114371214 CAGCTGGGGAGGCCTGGCCCAGG - Intronic
1060299739 9:122368235-122368257 CAGCTGGGGGTGCTGGCCCATGG + Intergenic
1060724971 9:126000540-126000562 AAGCTGCAGGTGCCTGGCTTGGG + Intergenic
1060778149 9:126391851-126391873 CAGCAGGGGGTGTCTGGGTTGGG + Intronic
1061246470 9:129403451-129403473 CAGCTGGGGCTGTGTGACCTCGG - Intergenic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1061361452 9:130144875-130144897 TAGATGAGGGTGGCTGGCCTGGG - Intergenic
1061806109 9:133138502-133138524 CAGCTGGGTGTGCCAGGCAGTGG + Intronic
1062352402 9:136145559-136145581 CAGTGGGGGCTGCCTGGCTTTGG + Intergenic
1062386392 9:136313320-136313342 CTGCGGGGGCTGCCTGGCCCCGG - Intergenic
1062428718 9:136517539-136517561 CAGATGAGGGTGCCGGGCCAGGG - Intronic
1062443689 9:136584533-136584555 CAGCTGGGGGAGGCTGGCCTTGG + Intergenic
1062537362 9:137026900-137026922 CAGCTCCAGGTGCCTGGCCAGGG + Intronic
1062552446 9:137095795-137095817 CAGCAGGGGGCGCCTGGCAAGGG + Intronic
1062582063 9:137233160-137233182 CAGGTGGGGGGGCCCGGGCTGGG - Intronic
1062610585 9:137371675-137371697 GCCCCGGGGGTGCCTGGCCTGGG - Intronic
1202800527 9_KI270719v1_random:170748-170770 CAGGTGGTGGAGCATGGCCTGGG - Intergenic
1203746810 Un_GL000218v1:44675-44697 CCCCTGAGGGGGCCTGGCCTGGG - Intergenic
1203563297 Un_KI270744v1:74805-74827 CCCCTGAGGGGGCCTGGCCTGGG + Intergenic
1186441954 X:9594020-9594042 CCGCTCGGGGTTACTGGCCTGGG + Intronic
1188003684 X:25003425-25003447 GAGCTGGGGGTCCCGGGCCACGG - Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic
1192236421 X:69299099-69299121 CAGGAGGGGCTTCCTGGCCTGGG - Intergenic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1196742037 X:119033570-119033592 TAGCTGGGAGTTCCTGGGCTGGG - Intergenic
1198158693 X:133986084-133986106 CAGGTGGGGGTCCCTGACTTAGG + Intergenic
1199615713 X:149653153-149653175 CTGCAGGGAGTACCTGGCCTGGG - Intergenic
1199686933 X:150273300-150273322 CAGCAGGGGGTCCCTGGACCTGG - Intergenic
1199699347 X:150364493-150364515 CAGCTGGGTGCGGCTGACCTGGG + Intronic
1200128167 X:153827934-153827956 GACTTGGGGGTTCCTGGCCTGGG + Intronic
1200152243 X:153956900-153956922 CGGCTGGGAGTGCCTCACCTGGG + Exonic
1200684492 Y:6246548-6246570 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200686680 Y:6265082-6265104 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1200989558 Y:9335998-9336020 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1200990021 Y:9337807-9337829 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200992229 Y:9356331-9356353 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1200992683 Y:9358122-9358144 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200994879 Y:9376609-9376631 CAGCTGCGGGAACGTGGCCTCGG + Intronic
1200995337 Y:9378401-9378423 CAGCAGGCTGTGCCTGGCCCTGG + Intronic
1200997543 Y:9396955-9396977 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1200998001 Y:9398746-9398768 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201000055 Y:9465491-9465513 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1201000510 Y:9467280-9467302 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201002716 Y:9485801-9485823 CAGCTGCGGGAACGTGGCCTCGG + Intronic
1201003178 Y:9487610-9487632 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201005371 Y:9506085-9506107 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1201005835 Y:9507892-9507914 CAGCAGGCTGTGCCTGGCCCTGG + Intergenic
1201008034 Y:9526414-9526436 CAGCTGCGGGAACGTGGCCTCGG + Intergenic
1201008491 Y:9528205-9528227 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201160137 Y:11159689-11159711 CCCCTGAGGGGGCCTGGCCTGGG - Intergenic