ID: 1171496287 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:25558289-25558311 |
| Sequence | CGCTTGAATCCAGGCGACGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 74082 | |||
| Summary | {0: 1, 1: 20, 2: 1062, 3: 13810, 4: 59189} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171496287_1171496294 | 12 | Left | 1171496287 | 20:25558289-25558311 | CCTCCGTCGCCTGGATTCAAGCG | 0: 1 1: 20 2: 1062 3: 13810 4: 59189 |
||
| Right | 1171496294 | 20:25558324-25558346 | CAGCCTCCCAAGTAGCTGGGAGG | 0: 71 1: 178 2: 331 3: 477 4: 830 |
||||
| 1171496287_1171496293 | 9 | Left | 1171496287 | 20:25558289-25558311 | CCTCCGTCGCCTGGATTCAAGCG | 0: 1 1: 20 2: 1062 3: 13810 4: 59189 |
||
| Right | 1171496293 | 20:25558321-25558343 | CCTCAGCCTCCCAAGTAGCTGGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||||
| 1171496287_1171496291 | 8 | Left | 1171496287 | 20:25558289-25558311 | CCTCCGTCGCCTGGATTCAAGCG | 0: 1 1: 20 2: 1062 3: 13810 4: 59189 |
||
| Right | 1171496291 | 20:25558320-25558342 | GCCTCAGCCTCCCAAGTAGCTGG | 0: 81212 1: 190903 2: 234468 3: 228974 4: 272812 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171496287 | Original CRISPR | CGCTTGAATCCAGGCGACGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||