ID: 1171496287

View in Genome Browser
Species Human (GRCh38)
Location 20:25558289-25558311
Sequence CGCTTGAATCCAGGCGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74082
Summary {0: 1, 1: 20, 2: 1062, 3: 13810, 4: 59189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171496287_1171496294 12 Left 1171496287 20:25558289-25558311 CCTCCGTCGCCTGGATTCAAGCG 0: 1
1: 20
2: 1062
3: 13810
4: 59189
Right 1171496294 20:25558324-25558346 CAGCCTCCCAAGTAGCTGGGAGG 0: 71
1: 178
2: 331
3: 477
4: 830
1171496287_1171496293 9 Left 1171496287 20:25558289-25558311 CCTCCGTCGCCTGGATTCAAGCG 0: 1
1: 20
2: 1062
3: 13810
4: 59189
Right 1171496293 20:25558321-25558343 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
1171496287_1171496291 8 Left 1171496287 20:25558289-25558311 CCTCCGTCGCCTGGATTCAAGCG 0: 1
1: 20
2: 1062
3: 13810
4: 59189
Right 1171496291 20:25558320-25558342 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171496287 Original CRISPR CGCTTGAATCCAGGCGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr