ID: 1171498562

View in Genome Browser
Species Human (GRCh38)
Location 20:25575507-25575529
Sequence CTTTGGGAGGGCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171498555_1171498562 -8 Left 1171498555 20:25575492-25575514 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
1171498552_1171498562 11 Left 1171498552 20:25575473-25575495 CCAGGTGTGGTGGCTTGCGCCTG 0: 37
1: 1420
2: 19389
3: 86903
4: 198580
Right 1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171498562 Original CRISPR CTTTGGGAGGGCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr