ID: 1171500910

View in Genome Browser
Species Human (GRCh38)
Location 20:25592651-25592673
Sequence CTTTAAACCACCTGAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171500910_1171500921 28 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG No data
1171500910_1171500914 -7 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500914 20:25592667-25592689 TTTAAAGTAGGTTGCCAAGGAGG No data
1171500910_1171500913 -10 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500913 20:25592664-25592686 TGGTTTAAAGTAGGTTGCCAAGG No data
1171500910_1171500918 26 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500918 20:25592700-25592722 TCCTTGCCTGCTGCTGTCCTGGG No data
1171500910_1171500920 27 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500920 20:25592701-25592723 CCTTGCCTGCTGCTGTCCTGGGG No data
1171500910_1171500917 25 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500917 20:25592699-25592721 CTCCTTGCCTGCTGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171500910 Original CRISPR CTTTAAACCACCTGAGGAAA AGG (reversed) Intergenic