ID: 1171500912

View in Genome Browser
Species Human (GRCh38)
Location 20:25592657-25592679
Sequence AACCTACTTTAAACCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171500912_1171500921 22 Left 1171500912 20:25592657-25592679 CCTCAGGTGGTTTAAAGTAGGTT No data
Right 1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG No data
1171500912_1171500917 19 Left 1171500912 20:25592657-25592679 CCTCAGGTGGTTTAAAGTAGGTT No data
Right 1171500917 20:25592699-25592721 CTCCTTGCCTGCTGCTGTCCTGG No data
1171500912_1171500920 21 Left 1171500912 20:25592657-25592679 CCTCAGGTGGTTTAAAGTAGGTT No data
Right 1171500920 20:25592701-25592723 CCTTGCCTGCTGCTGTCCTGGGG No data
1171500912_1171500918 20 Left 1171500912 20:25592657-25592679 CCTCAGGTGGTTTAAAGTAGGTT No data
Right 1171500918 20:25592700-25592722 TCCTTGCCTGCTGCTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171500912 Original CRISPR AACCTACTTTAAACCACCTG AGG (reversed) Intergenic