ID: 1171500921

View in Genome Browser
Species Human (GRCh38)
Location 20:25592702-25592724
Sequence CTTGCCTGCTGCTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171500910_1171500921 28 Left 1171500910 20:25592651-25592673 CCTTTTCCTCAGGTGGTTTAAAG No data
Right 1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG No data
1171500912_1171500921 22 Left 1171500912 20:25592657-25592679 CCTCAGGTGGTTTAAAGTAGGTT No data
Right 1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG No data
1171500915_1171500921 -2 Left 1171500915 20:25592681-25592703 CCAAGGAGGCCGATCTTGCTCCT No data
Right 1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171500921 Original CRISPR CTTGCCTGCTGCTGTCCTGG GGG Intergenic