ID: 1171504506

View in Genome Browser
Species Human (GRCh38)
Location 20:25623035-25623057
Sequence CTGATGAAGCATGAAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171504504_1171504506 -4 Left 1171504504 20:25623016-25623038 CCAGGGACACAAAAACTAACTGA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG 0: 1
1: 0
2: 1
3: 34
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171504506 Original CRISPR CTGATGAAGCATGAAGAGGA CGG Intronic
901153090 1:7117397-7117419 TTGATGAAGCAAGAAGTGCATGG + Intronic
902295114 1:15461872-15461894 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902297979 1:15481411-15481433 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902613724 1:17612332-17612354 CAGATGAAGGAATAAGAGGATGG - Intronic
902645749 1:17796752-17796774 CTGAAGAAGCTTGAAGAGGTCGG - Intronic
902908695 1:19578948-19578970 CTGATGATGCAAGAAGAGAGAGG - Intergenic
904292348 1:29496192-29496214 CTGATTCAGCATGCAGAGCATGG - Intergenic
904972796 1:34432262-34432284 CTGGTTAAACTTGAAGAGGAGGG + Intergenic
906108098 1:43306654-43306676 CTGGTGGAGCATGAAGAAGAGGG + Intronic
906418013 1:45637503-45637525 CTCTTGAAGCTTGAAGAGGATGG - Intronic
907015272 1:51006002-51006024 CTGACGAAGCTTCCAGAGGAAGG + Intergenic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
908245781 1:62226813-62226835 GTCTTGAAGCATGAATAGGAAGG - Intergenic
909666798 1:78143226-78143248 CTAAAGAAGCCTGAAGAGGAGGG - Intergenic
909770448 1:79414934-79414956 GAGATGAAGCATTCAGAGGAAGG + Intergenic
909897327 1:81089055-81089077 GAGATGAATCATGAAGAGGAGGG - Intergenic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
911108561 1:94158886-94158908 CTTAAGAAGCAAGAAGAGGCTGG - Intronic
914441472 1:147711420-147711442 GTGATGAAGCTTCCAGAGGAAGG - Intergenic
915713160 1:157920399-157920421 CTGAAGGAGCAAGGAGAGGAAGG - Intergenic
916430960 1:164727991-164728013 CAAATGAAGAATGAATAGGAAGG - Intronic
916833175 1:168513902-168513924 TTGATGAGGCAAGAAGGGGATGG - Intergenic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
917406046 1:174709455-174709477 CTGATGAAGCTTCCAGAGGAAGG + Intronic
917700072 1:177571503-177571525 CTGATGAAGGGAGTAGAGGAAGG - Intergenic
918431214 1:184462761-184462783 CTGATGTTGGATGGAGAGGAAGG - Intronic
918741894 1:188142404-188142426 CTGAGGACTCTTGAAGAGGAAGG + Intergenic
919436067 1:197562722-197562744 ATGATGAAGCTTGTTGAGGAAGG + Intronic
919935926 1:202250941-202250963 CTGAGGAAGAATGTAGAGGAAGG - Intronic
920139436 1:203797146-203797168 TTGATGAAGCAGGAAGAACATGG + Exonic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921354181 1:214270031-214270053 CTGATCTTACATGAAGAGGATGG + Intergenic
921435169 1:215110773-215110795 CTGATGAAGGATGTTGATGATGG - Intronic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922014991 1:221636243-221636265 GAGATGCAGGATGAAGAGGATGG + Intergenic
922380860 1:225023384-225023406 CTAAAGAAGCCAGAAGAGGAAGG - Intronic
922666628 1:227474680-227474702 GTGATGAAGCTTCCAGAGGAAGG + Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1064661379 10:17611301-17611323 CTGTTGAGGCATCAAGAAGAGGG - Intronic
1064757941 10:18588558-18588580 CAGATGAAGCTTCCAGAGGAAGG + Intronic
1065966201 10:30772623-30772645 GGGATGAAGCAGGAAGAGAATGG - Intergenic
1066571445 10:36777269-36777291 CTGATGAATCAGGAAAAGGGAGG + Intergenic
1067741637 10:48899977-48899999 CTGTTGAAGCAGGAAGCGAAAGG - Intronic
1070018707 10:72562015-72562037 GTGATGAACAATGAAAAGGATGG - Intronic
1070681361 10:78451556-78451578 CTGATGAAGCCTGATCAGGTGGG - Intergenic
1073564325 10:104522204-104522226 CTGCTGAAGATTGAAGAGGACGG + Intergenic
1073586018 10:104710850-104710872 CATGTGAAGCATGAGGAGGAGGG + Intronic
1073771059 10:106736408-106736430 CTGTGGGAACATGAAGAGGAAGG - Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074215068 10:111376249-111376271 CTGATGAAGAATTTGGAGGAAGG - Intergenic
1074356445 10:112789594-112789616 CTGATGAAAAATGAACAGGGAGG - Intronic
1074370732 10:112898940-112898962 CTAATGAGGCCTGAAGTGGAGGG - Intergenic
1074524870 10:114254480-114254502 CTGATGAGGGTGGAAGAGGAAGG - Intronic
1074681166 10:115909168-115909190 CTGACTGGGCATGAAGAGGAAGG - Intronic
1075498620 10:122952140-122952162 CTGGTGAGGCATGAAGAGTTGGG + Intronic
1076564912 10:131392030-131392052 GTGATAAAACATGAAGTGGATGG + Intergenic
1077579475 11:3407632-3407654 CTGGTGAAACATGAAGAAAATGG + Intergenic
1077890609 11:6415530-6415552 ATCATGAAGGAGGAAGAGGAGGG + Intronic
1078571352 11:12460824-12460846 CAGGTGATGCATGAAGACGAAGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1080443266 11:32314407-32314429 CTGATGAATCACTAAGAGGCTGG + Intergenic
1081535658 11:43994381-43994403 CTGATGAAGCAGTCAGAGGCTGG - Intergenic
1081754044 11:45532102-45532124 CTGCTGAACCATTAAGAGGCTGG + Intergenic
1083379252 11:62251612-62251634 CTCAAGAAGCATGAACAGAAAGG + Intergenic
1084022154 11:66424194-66424216 CTCATGGAGGCTGAAGAGGAAGG - Exonic
1084236508 11:67791170-67791192 CTGGTGAAACATGAAGAAAATGG + Intergenic
1084405137 11:68967709-68967731 CTGATGAAGGAGGCAGAGGCTGG - Intergenic
1084835919 11:71801823-71801845 CTGGTGAAACATGAAGAAAATGG - Intergenic
1085160629 11:74340772-74340794 GTAATGAAACCTGAAGAGGAAGG + Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086923766 11:92617832-92617854 GAGATGAAGCATCCAGAGGAAGG - Intronic
1087614675 11:100474294-100474316 ATGACGAAGCATGCACAGGAAGG + Intergenic
1088067031 11:105732122-105732144 CTGAGGAAGCATGAACAATAAGG + Intronic
1091282566 11:134390350-134390372 CTGATGAAGGATGGGGAGGCTGG + Exonic
1091602017 12:1923480-1923502 ATGATGAACTATTAAGAGGAAGG + Intergenic
1095278612 12:40322489-40322511 TTGATGAAGAAAGCAGAGGAAGG + Exonic
1095965637 12:47865158-47865180 CAGGCGAAGCATGAAGCGGAAGG - Exonic
1096030477 12:48409784-48409806 GTGATGAAGCTTCTAGAGGAAGG - Intergenic
1096365030 12:51021782-51021804 GTTAGGAAGCAAGAAGAGGAGGG + Intronic
1098040968 12:66353805-66353827 CTGATGACGACTGAAAAGGAGGG - Intronic
1098083366 12:66813655-66813677 TTGATACAGCATGAACAGGAAGG + Intergenic
1099740433 12:86627505-86627527 GAGATGAAGCATCCAGAGGAAGG + Intronic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1104315246 12:127692824-127692846 CTGATGAAACATGAACATCAGGG + Intergenic
1104395742 12:128431012-128431034 ATGATGAAGCTTCATGAGGAAGG + Intronic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1104439107 12:128780789-128780811 GTCATGAAGAATGAAGATGAGGG + Intergenic
1105286219 13:19007098-19007120 GAGATGAAGCATCCAGAGGAAGG - Intergenic
1105332138 13:19427674-19427696 CTGATAAAACATGATGAGCAGGG - Intronic
1105879671 13:24593092-24593114 CTGATAAAACATGATGAGCAGGG + Intergenic
1105920172 13:24955987-24956009 CTGATAAAACATGATGAGCAGGG - Intergenic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1107485962 13:40827749-40827771 CTGATAAAACATGATGAGCAGGG - Intergenic
1109177949 13:59178496-59178518 CTGAGGAAGCCTAAAGAAGAAGG + Intergenic
1109731640 13:66420463-66420485 TTGATGAAGCTTCCAGAGGAAGG + Intronic
1112165942 13:96919498-96919520 GGGATGAAGCTTCAAGAGGAAGG + Intergenic
1112169892 13:96960353-96960375 CTGATGAAGCCACAAGTGGAAGG + Intergenic
1112215770 13:97430482-97430504 CTGATTAAACATAAAGGGGAAGG - Intergenic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1113664582 13:112132309-112132331 TTGTGGAAGCATGAAGTGGAGGG + Intergenic
1114573173 14:23689907-23689929 GGGATGAAGCTTCAAGAGGAAGG - Intergenic
1117195032 14:53331216-53331238 CTGATCAAGGATGCTGAGGAAGG + Intergenic
1117256598 14:53984587-53984609 TTGATGTAGCATGAAGAAGTTGG - Intergenic
1119456871 14:74763622-74763644 CTCATGAAGCCCGAGGAGGAGGG - Exonic
1119582857 14:75803150-75803172 CTCAGGTAGCTTGAAGAGGATGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121144077 14:91568471-91568493 CTCAGGAAGCAAGCAGAGGAAGG - Intergenic
1124957790 15:34370959-34370981 CGGAAGAAGGAAGAAGAGGAGGG - Intergenic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1126804398 15:52331742-52331764 CTGCTGCAGCATGAGGTGGACGG - Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127118946 15:55754620-55754642 CTAATGAAGCATGAAGGTGTTGG - Intergenic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128207796 15:65868665-65868687 TTGATGAATCTTGATGAGGAGGG + Intronic
1128367406 15:67014071-67014093 CTAATGCAGGAAGAAGAGGAAGG - Intergenic
1128600556 15:68992086-68992108 CTCATAAAGCTTGAAGAGCAAGG + Intronic
1129231571 15:74199858-74199880 GTGCTGAAGGATGCAGAGGAGGG + Intronic
1130399803 15:83539593-83539615 CTGATGAGTCATGAAGAAAAAGG - Intronic
1131869330 15:96745387-96745409 ATGGTGAATGATGAAGAGGAAGG - Intergenic
1133348093 16:5083692-5083714 CTGGTGAAACATGAAGAAAATGG + Exonic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134793424 16:17012176-17012198 CTAATGAAGGATGATCAGGAAGG + Intergenic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136317025 16:29460447-29460469 CTGATGACTCATCAAAAGGAGGG - Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136431600 16:30199789-30199811 CTGATGACTCATCAAAAGGAGGG - Intronic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1138799822 16:60013566-60013588 GGGATGAAGCTTCAAGAGGAAGG + Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139892184 16:70260443-70260465 ATGCTGAAGAATGAAGAGGTAGG - Intronic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1143692498 17:8581146-8581168 CAGATGGAGCAGGAAGGGGAGGG + Intronic
1143709445 17:8724227-8724249 CTTCTGAAGAAAGAAGAGGAGGG - Intergenic
1144157048 17:12514808-12514830 CTGATGAGGCACGCAGAGTATGG - Intergenic
1144255681 17:13464802-13464824 GTGATGAAGGATATAGAGGAGGG - Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145764606 17:27449710-27449732 CTGATGAAGCATGGCATGGAGGG + Intergenic
1148338941 17:46861687-46861709 GAGATGAAGGCTGAAGAGGAGGG + Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1150143944 17:62752452-62752474 CTGAGGAAGCAAGGAGAGGGTGG - Intronic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1154031239 18:10756039-10756061 GGGATGCAGGATGAAGAGGAGGG + Intronic
1154123456 18:11670034-11670056 ACCGTGAAGCATGAAGAGGAAGG + Intergenic
1155290940 18:24340888-24340910 CTGATGAAACATGACAATGAAGG - Intronic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155768638 18:29670649-29670671 CAAATGAAAGATGAAGAGGAAGG + Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1157370294 18:47104644-47104666 TTGATGAATGATGAAGAAGAAGG - Intergenic
1157443838 18:47730174-47730196 CTGATGAAGGATGAAGCTGGGGG - Intergenic
1158070926 18:53469635-53469657 CTGATGATGCAGGAAAGGGAAGG - Intronic
1158853464 18:61518398-61518420 GTGAAGAAGCTTCAAGAGGAAGG + Intronic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1162142550 19:8593286-8593308 CTGCTGAGGAATGAACAGGAAGG + Intronic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163338010 19:16686314-16686336 CTGCTGGAGGGTGAAGAGGATGG - Exonic
1163449250 19:17365976-17365998 CTGATTCAGCATGAAGAGCAAGG + Exonic
1164047446 19:21555002-21555024 GTGATGAAGCTTCCAGAGGAAGG - Intronic
1166985590 19:46658695-46658717 CTTATTAAGCCTGCAGAGGAAGG - Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
926000937 2:9331915-9331937 CTGCAGAAGCTTGCAGAGGAGGG + Intronic
926023886 2:9522010-9522032 CTGATGAAGGATGGATTGGAGGG - Intronic
926058189 2:9788859-9788881 CTGAAGAAGAGTGAAGATGAAGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926434508 2:12824501-12824523 CTAAGGAAGCATGAAGGGGGAGG + Intergenic
927075623 2:19574095-19574117 ATGATGATGAATGAAGATGAAGG - Intergenic
928176767 2:29039258-29039280 CTTATGGAGCATGAAGAAGGAGG - Intronic
929700882 2:44161961-44161983 CTGAGGACACATCAAGAGGATGG + Intergenic
930018219 2:46985191-46985213 CTCAGGAAGAAAGAAGAGGAAGG - Intronic
930292667 2:49515397-49515419 ATTATGAAGCTTGAAGAGAATGG + Intergenic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932470330 2:71950942-71950964 CTGCTGAAGGATGAACAGCAGGG - Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
938012986 2:127843729-127843751 CTGATGTAGTATTAAGAGGTGGG + Intergenic
938031555 2:127998909-127998931 CTGATGACGCAGGCAGAGGAAGG + Intronic
940827187 2:158425755-158425777 CAGATGAAGCCTTAAGAGCATGG - Intronic
942110306 2:172675300-172675322 CTGATTAAGCTTGCTGAGGAGGG + Intergenic
942253029 2:174063876-174063898 CTGATGAAGCAAGAGGGAGAGGG - Intergenic
943593903 2:189832202-189832224 CTTAAGAATCATGTAGAGGATGG + Intronic
943612790 2:190053933-190053955 CTGATGGAGGGTGGAGAGGAGGG + Intronic
944107033 2:196089941-196089963 GTGATGAAGCTTCCAGAGGAAGG + Intergenic
946096156 2:217275684-217275706 CTGAGGAAGCTTGAACAGGTAGG + Intergenic
946496696 2:220202633-220202655 CAGATGAACCATGAGGAGCATGG - Intergenic
946941297 2:224772557-224772579 CTGAAGATGCAAGGAGAGGAGGG - Intronic
947525697 2:230875495-230875517 CTGCGGAAGCAAGAAGAGCAGGG - Intronic
948483294 2:238263922-238263944 CTGAAGGAGGAAGAAGAGGAAGG + Intronic
1170594030 20:17792239-17792261 CGGGTGAAGCATGAAGGGCATGG + Intergenic
1170780842 20:19423987-19424009 GTTATGAAGCATGAAAAGGAAGG + Intronic
1171011831 20:21513226-21513248 CTAAGGAGGCTTGAAGAGGAGGG + Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1172697470 20:36832447-36832469 CTGGGGAATCATGGAGAGGATGG - Intronic
1172783512 20:37451168-37451190 AAGATGAAGCCTGGAGAGGAGGG - Intergenic
1173131584 20:40398917-40398939 CAGACGAAGCCTGAAGGGGATGG + Intergenic
1174106679 20:48167165-48167187 GGGATGAAGGTTGAAGAGGAAGG + Intergenic
1176740875 21:10600909-10600931 CTGATAAAACATGATGAGCAGGG + Intronic
1176878027 21:14153670-14153692 CTGTTGTAGCATGAAGATGGAGG + Intronic
1177079379 21:16619743-16619765 CAGAGAAAGCATGAAGAGCAAGG + Intergenic
1178295762 21:31408994-31409016 CTGATGAAGCCTGGAGGGGGGGG - Intronic
1178322593 21:31616742-31616764 CTGATGTCCCCTGAAGAGGAGGG + Intergenic
1178891670 21:36525340-36525362 GTCTTGAAGGATGAAGAGGATGG + Intronic
1178966841 21:37128203-37128225 CTGATGAAGGTTTAAGGGGAGGG - Intronic
1179019810 21:37628748-37628770 CTGTTGAAACATGACGATGAAGG + Intronic
1179730558 21:43365094-43365116 CTGACGAAGCCTGGAGAGGCAGG + Intergenic
1180900099 22:19364813-19364835 ATGATTAAGCTTAAAGAGGAAGG + Intronic
1181594922 22:23908038-23908060 CTGATGCAGCCTGAAGGGGTGGG - Intergenic
1181907587 22:26211641-26211663 CTGATGATGCTTGAATGGGATGG - Intronic
1182129974 22:27843707-27843729 AGGATGAAGGATGAAGAGGAGGG + Intergenic
1182419349 22:30241392-30241414 CGGATGAAGCAGGAAGGAGAAGG + Exonic
1183179718 22:36251990-36252012 CTTATGAGGCAGGAAGAGAATGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
949746673 3:7302499-7302521 CTGACGAAGTTTGAAGAGAAAGG - Intronic
952109219 3:30103606-30103628 TTGTTGAAGGATGAAGATGAAGG + Intergenic
952501782 3:33970038-33970060 CAGATGAAGCTTCCAGAGGAAGG - Intergenic
952858356 3:37792017-37792039 GAGATGTAGGATGAAGAGGAGGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953337351 3:42104487-42104509 GAGATGAAGCATCCAGAGGAAGG + Intronic
953555148 3:43939803-43939825 GGGATGAAGCATTCAGAGGAAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
955411052 3:58655649-58655671 GTGATCAAGCCTGAAGATGAGGG + Intronic
956202735 3:66723108-66723130 CTGTTGAAGGATGCAAAGGATGG + Intergenic
956396729 3:68834000-68834022 CTAATGGAGCATGAAGAGTTGGG - Intronic
957052450 3:75420954-75420976 CTGGTGAAACATGAAGAAAATGG + Intergenic
959120026 3:102222453-102222475 GTGATGAAGCTTCCAGAGGAAGG - Intronic
959134125 3:102395415-102395437 CTGATGAAAGACGAAGAGGTTGG + Intronic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
960163795 3:114379068-114379090 ATGATGAAGCAAGTAGAGAATGG + Intronic
960953189 3:123012759-123012781 AGGATGAAGGAGGAAGAGGAGGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961302398 3:125930597-125930619 CTGGTGAAACATGAAGAAAATGG - Exonic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
962492433 3:135907498-135907520 CTGATGGAGCAAGAAGAACATGG - Intergenic
962735878 3:138324794-138324816 GTGATGAACCATGAAGAGAAGGG - Intronic
963726759 3:148931650-148931672 CAGAGGAAGCATGGAGAGAACGG - Intergenic
964480629 3:157134930-157134952 CTGATGCAGCATGATAGGGATGG + Intergenic
964995071 3:162868561-162868583 GGGATGAAGCTTCAAGAGGAAGG + Intergenic
965449574 3:168820844-168820866 CTGCTGCAGCATGGAGATGACGG - Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
969577244 4:8043606-8043628 GTGATGATGCAAGGAGAGGACGG + Intronic
969818704 4:9704927-9704949 CTGGTGAAACATGAAGAAAACGG - Intergenic
969990707 4:11259759-11259781 CTGGTGAGGCATGATAAGGAAGG + Intergenic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970547726 4:17146847-17146869 CTAATGACCCAGGAAGAGGAAGG + Intergenic
971883333 4:32410145-32410167 CAGATGAAGCTTCCAGAGGAAGG + Intergenic
971942467 4:33233511-33233533 CTGTTAAAGCCTGAAGAGGAAGG + Intergenic
972360615 4:38322715-38322737 CTGATGAAGGAGGGAGAGGGAGG - Intergenic
972417987 4:38861502-38861524 CAGAAGAATAATGAAGAGGATGG - Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
974631856 4:64501601-64501623 CTAATGAAGAATGAAGATAATGG + Intergenic
975235946 4:71996809-71996831 GAGATGAAGCTTGCAGAGGAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975668063 4:76753759-76753781 CTGATGAAAAATAAAAAGGAGGG - Intronic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976717699 4:88140297-88140319 CTGATAAAGCAGGAAAAGGATGG + Intronic
977425628 4:96863644-96863666 GTGATGAAGCTTCCAGAGGAAGG + Intergenic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
979107611 4:116707084-116707106 GTGATCCAGCATTAAGAGGAGGG + Intergenic
979212372 4:118120531-118120553 CTGATAAAGGAAGCAGAGGAGGG + Intronic
979672997 4:123381203-123381225 CTGATGGGGTATGAAGAGTAAGG + Intergenic
979966233 4:127079233-127079255 GAGATGGAGCATGAAGAGAAAGG - Intergenic
980171849 4:129298734-129298756 CTGTTGGAGCATGAGGAAGATGG + Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
981131662 4:141163584-141163606 CGGATGAAGCTTCCAGAGGAAGG + Intronic
981497447 4:145410066-145410088 CAGATGAAGGTTGCAGAGGAAGG + Intergenic
981716103 4:147753868-147753890 CAAATTAAGCATCAAGAGGAAGG - Intronic
982883339 4:160747125-160747147 GTGATGAAACTTCAAGAGGAAGG + Intergenic
983045466 4:162981828-162981850 TTGTTGAATCTTGAAGAGGAGGG - Intergenic
983104751 4:163672852-163672874 GTGATGCAGTTTGAAGAGGAAGG - Intronic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
985385051 4:189436751-189436773 CTGAGAAGCCATGAAGAGGAGGG - Intergenic
985792792 5:1939425-1939447 CTCATGCAGCCTGACGAGGAGGG - Intergenic
986517870 5:8582137-8582159 CTGGTAAAACATGAAGTGGAGGG - Intergenic
987720826 5:21630114-21630136 CTGATACAGCAGGAAGAGAAAGG + Intergenic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
989623058 5:43403303-43403325 GAGATGAAGCTTGCAGAGGAAGG + Intronic
990470613 5:56111857-56111879 CTGATGAAGCATGTGGAATAGGG - Intronic
990668942 5:58105500-58105522 GGGATGAAGCATCAAGAAGAAGG - Intergenic
990793671 5:59514655-59514677 CTGTTGAACAATGAAGAGAATGG - Intronic
990901586 5:60756163-60756185 CTGATGTAGAAAGAATAGGATGG - Intronic
990978515 5:61580205-61580227 ATGATGGAGCATGATGAGCAAGG + Intergenic
991652160 5:68866049-68866071 GGGATGAAGCTTGCAGAGGAAGG + Intergenic
993420994 5:87700809-87700831 CTGATGAACCATGGAGATCATGG + Intergenic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993761626 5:91802823-91802845 CTGATGAAGAGTGAGGAGGGAGG - Intergenic
995670073 5:114593210-114593232 ATGATTAAGCTTAAAGAGGAAGG - Intergenic
995820674 5:116227362-116227384 CTGATGGAGAATAAAGAGGCTGG - Intronic
996342889 5:122457629-122457651 CTAAGGAAGCATGAGGAGGCAGG - Intronic
996599981 5:125251958-125251980 CTGATTAAGGATGATGAGAAAGG + Intergenic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998402965 5:141857557-141857579 CTGTTGAAGCCTGAGTAGGATGG - Intronic
999333517 5:150694915-150694937 ATGATGAATTATGTAGAGGAGGG - Intronic
999426699 5:151493783-151493805 CTGTTGCAGCCTCAAGAGGAAGG + Intergenic
999495126 5:152089318-152089340 CTGATGAAGAATTAGGAGGCTGG - Intergenic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000122935 5:158215045-158215067 CTCATGATGCATGGACAGGAAGG - Intergenic
1000716307 5:164649252-164649274 CTGATGAACCATGAAGACAAGGG - Intergenic
1001854044 5:174995388-174995410 GTGAAGAAGAATGAAGTGGAGGG + Intergenic
1002573286 5:180156232-180156254 CTGATGGTGCAAGGAGAGGACGG + Intronic
1005394521 6:25367572-25367594 CTGTTAAGGCTTGAAGAGGAAGG + Intronic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1006577442 6:35056826-35056848 GTGCTGAAGCGTGGAGAGGATGG + Intronic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006909620 6:37555512-37555534 CTCAGGGAGCATGAAGGGGATGG - Intergenic
1007013951 6:38443959-38443981 CTGATGCAGCCTGTAGAGGCAGG - Intronic
1007700022 6:43761033-43761055 CTGAGGAGGCATGGAGAGGCAGG + Intergenic
1007794081 6:44333506-44333528 CTGCAGAAGACTGAAGAGGAAGG + Intronic
1007813979 6:44507075-44507097 ATGATGATGGAGGAAGAGGAGGG + Intergenic
1008088632 6:47270275-47270297 CGGATGAAGCTTCCAGAGGAAGG + Intronic
1009455905 6:63855750-63855772 CTGATAAAGGGTGAAGAAGATGG + Intronic
1009651515 6:66482335-66482357 CTGATAAACTTTGAAGAGGATGG + Intergenic
1010790765 6:80062482-80062504 CTTATGAAGCATAGAGAAGACGG - Intergenic
1011884692 6:92079049-92079071 GGGATGAAGCATCCAGAGGAAGG + Intergenic
1012436096 6:99216491-99216513 CTGATAAAGCATAAAGTGGGAGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014078643 6:117265098-117265120 CTGATGATGTATGGGGAGGACGG - Intergenic
1014826757 6:126055762-126055784 CTGAGGAAGCATGAAAAAGATGG - Intergenic
1016717603 6:147251865-147251887 GGGATGAAGCATCCAGAGGAAGG + Intronic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017539771 6:155388747-155388769 TTGATGAAGCATGGTGAGCAGGG + Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1018837023 6:167492809-167492831 CTGATAAGGCATGAAGAGGGAGG + Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019370280 7:659570-659592 CTGGTGAGGCAAGAAGACGACGG + Intronic
1019576128 7:1738435-1738457 TTGATCAAACATGAAGTGGATGG + Intronic
1020319528 7:6929655-6929677 CTGGTGAAACATGAAGAAAATGG + Intergenic
1020417741 7:7965619-7965641 CAGATGGAGCTAGAAGAGGAAGG + Intronic
1020599020 7:10248614-10248636 GTGATGAAGCTTCCAGAGGAAGG + Intergenic
1021207955 7:17807746-17807768 GGGATGAAGCATCCAGAGGAAGG + Intronic
1021805204 7:24348661-24348683 CTGATGAGGCATGATGTGGAAGG + Intergenic
1021824552 7:24535913-24535935 GAGATGAAGGAGGAAGAGGAAGG - Intergenic
1022178469 7:27895231-27895253 CTGCTGCGGAATGAAGAGGAGGG + Exonic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023126374 7:36958463-36958485 CTGATGAAAAATGAGGAGGGAGG - Intronic
1023551482 7:41374522-41374544 CTGATGAAGCATAAATGGCAAGG + Intergenic
1024016934 7:45325657-45325679 CTACTGCAGCATGAAGATGAAGG + Intergenic
1024495533 7:50041438-50041460 GTGATGAAGCTTCCAGAGGAAGG + Intronic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1027864478 7:83629167-83629189 CAGATGAAGCTTCCAGAGGAAGG - Intronic
1028530747 7:91835966-91835988 CTTTTGTAGCCTGAAGAGGAAGG - Intronic
1029701856 7:102252391-102252413 CTCATAGAGCGTGAAGAGGAAGG - Exonic
1029919843 7:104251589-104251611 CTGAGGAAGAATGAAGAGGGAGG + Intergenic
1030325758 7:108217279-108217301 GGGATGAAGCATCCAGAGGAGGG - Intronic
1030482384 7:110120452-110120474 GTGATGAAGCTTCCAGAGGAAGG + Intergenic
1030996213 7:116361491-116361513 ATGGTGAAAGATGAAGAGGAAGG - Intronic
1031254390 7:119428879-119428901 GGGATGAAGCATCCAGAGGAAGG + Intergenic
1032352673 7:131180256-131180278 CTGCTGTAGCGTGAAGGGGAAGG - Intronic
1032928289 7:136635181-136635203 CTGATGAAACATAAATAGGCTGG + Intergenic
1032945237 7:136844286-136844308 TTTCTGAAGGATGAAGAGGAAGG + Intergenic
1033542743 7:142372328-142372350 CTAAGGAAGCCTGAAGGGGAAGG + Intergenic
1035676523 8:1460463-1460485 CTGATGAAGCCAGCAGAGCAGGG + Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036110128 8:5889761-5889783 GTGATGATGCAGGGAGAGGATGG - Intergenic
1036568784 8:9961340-9961362 GTGATGAGGCATCAAGAAGAGGG + Intergenic
1037289601 8:17336726-17336748 GTGCTGAGGCATGAAGAGAAGGG - Intronic
1039189463 8:34956221-34956243 CTAATGAATCATGATGATGATGG + Intergenic
1039789854 8:40866637-40866659 TTGATGAATAATTAAGAGGAGGG + Intronic
1041534363 8:58909410-58909432 CTGATTCAGCATGTACAGGATGG - Intronic
1041739741 8:61145563-61145585 CTGATGCAGCAGGAGGGGGAAGG - Intronic
1042488835 8:69376521-69376543 GTGAGACAGCATGAAGAGGATGG - Intergenic
1044228893 8:89751441-89751463 AGGATGAAGAAAGAAGAGGAAGG + Intergenic
1044762328 8:95534368-95534390 CTGAGGAAGAATGAAGTAGAAGG + Intergenic
1045054087 8:98354373-98354395 CTGGTGAAGGAAGGAGAGGAGGG - Intergenic
1047361766 8:124175648-124175670 CTGATGGGGAAGGAAGAGGAGGG - Intergenic
1048165610 8:132059080-132059102 TTGATGAAGGAAGAAAAGGAGGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048869445 8:138785150-138785172 CTGGTGGAGGCTGAAGAGGAAGG - Intronic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1050229182 9:3500202-3500224 AGGATGAAGCAAGAAGAGAATGG + Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1051027423 9:12630111-12630133 CTGAAGCAGCATGAATAGGCAGG + Intergenic
1051243261 9:15082506-15082528 CTGATAAAGCGTGCTGAGGAAGG + Intergenic
1052705650 9:31990455-31990477 ATGATGAAGCTTCTAGAGGAAGG + Intergenic
1053186563 9:36021509-36021531 CTGATGGGGAATGAGGAGGAGGG + Intergenic
1054757541 9:68974168-68974190 CTTAGCAAGAATGAAGAGGAAGG - Intronic
1055398637 9:75899775-75899797 GAGATGAAGCATGAAGAGAGGGG + Intronic
1056246422 9:84699904-84699926 CTGATGAAAAATGAAAAGAAAGG + Intronic
1056577281 9:87866003-87866025 CTGATGGATGGTGAAGAGGAAGG + Intergenic
1057182416 9:93037268-93037290 CTACTGAAGCAGGCAGAGGACGG - Intergenic
1057452222 9:95175028-95175050 CTGTTGAATCATGATGGGGAAGG - Intronic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1060714044 9:125904491-125904513 AGGAGGAAGCATGAAGTGGAAGG - Intronic
1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189181471 X:39008735-39008757 CTAATGAAGCTTGGAGAGGGAGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197600531 X:128521825-128521847 CTGAAACAGCATGTAGAGGATGG + Intergenic
1200080237 X:153572633-153572655 CTGACAATGCATGCAGAGGAGGG - Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201563507 Y:15343226-15343248 GAGATGAAGCATTCAGAGGAAGG - Intergenic
1202257017 Y:22932074-22932096 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202410008 Y:24565822-24565844 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202460774 Y:25104250-25104272 CTGAGGAGGCAGGAAGAGAATGG + Intergenic
1202599137 Y:26574766-26574788 CTGATAAAACATGATGAGCAGGG + Intergenic