ID: 1171508347

View in Genome Browser
Species Human (GRCh38)
Location 20:25658171-25658193
Sequence GTTCACCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171508347_1171508348 5 Left 1171508347 20:25658171-25658193 CCTACAGCATGGTGCTGGTGAAC No data
Right 1171508348 20:25658199-25658221 CTCTGATTTAGCATCTCCTTTGG No data
1171508347_1171508351 30 Left 1171508347 20:25658171-25658193 CCTACAGCATGGTGCTGGTGAAC No data
Right 1171508351 20:25658224-25658246 GAGTTACAAAGCGGTTTCTGAGG No data
1171508347_1171508350 21 Left 1171508347 20:25658171-25658193 CCTACAGCATGGTGCTGGTGAAC No data
Right 1171508350 20:25658215-25658237 CCTTTGGCTGAGTTACAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171508347 Original CRISPR GTTCACCAGCACCATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr