ID: 1171510000

View in Genome Browser
Species Human (GRCh38)
Location 20:25674491-25674513
Sequence CAGTGTAAGTATTAGGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171510000_1171510007 27 Left 1171510000 20:25674491-25674513 CCCACCTCCTAATACTTACACTG 0: 1
1: 0
2: 5
3: 42
4: 428
Right 1171510007 20:25674541-25674563 TTTCAACATAAATTAAGGAGGGG 0: 1
1: 0
2: 23
3: 243
4: 1142
1171510000_1171510005 25 Left 1171510000 20:25674491-25674513 CCCACCTCCTAATACTTACACTG 0: 1
1: 0
2: 5
3: 42
4: 428
Right 1171510005 20:25674539-25674561 AGTTTCAACATAAATTAAGGAGG 0: 1
1: 0
2: 23
3: 258
4: 788
1171510000_1171510006 26 Left 1171510000 20:25674491-25674513 CCCACCTCCTAATACTTACACTG 0: 1
1: 0
2: 5
3: 42
4: 428
Right 1171510006 20:25674540-25674562 GTTTCAACATAAATTAAGGAGGG 0: 1
1: 0
2: 28
3: 230
4: 781
1171510000_1171510004 22 Left 1171510000 20:25674491-25674513 CCCACCTCCTAATACTTACACTG 0: 1
1: 0
2: 5
3: 42
4: 428
Right 1171510004 20:25674536-25674558 TAGAGTTTCAACATAAATTAAGG 0: 1
1: 0
2: 8
3: 104
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171510000 Original CRISPR CAGTGTAAGTATTAGGAGGT GGG (reversed) Exonic
901219694 1:7576387-7576409 CAGTGATGGTATTAGGAAGTGGG + Intronic
902032034 1:13430232-13430254 CAGTGAAAGTGCTAGCAGGTTGG - Intergenic
902902652 1:19530253-19530275 AAGTGATGGTATTAGGAGGTGGG + Intergenic
903985275 1:27222995-27223017 AAGTGATAGTATTAGGAGGTGGG - Intergenic
904862009 1:33545621-33545643 CAGTGATAGTATTAGGAAGTGGG - Intronic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
905098734 1:35499281-35499303 AAGTGATGGTATTAGGAGGTAGG + Intronic
905534007 1:38704747-38704769 AAGTGATGGTATTAGGAGGTGGG + Intergenic
905916986 1:41691447-41691469 AGGTGATAGTATTAGGAGGTGGG + Intronic
906375876 1:45296258-45296280 CAAGGTATGTATTAGGAGATGGG + Intronic
906559825 1:46748344-46748366 CAGTGACAGAATTGGGAGGTAGG - Intergenic
906857113 1:49319891-49319913 CAGTAACAGTATTAAGAGGTGGG - Intronic
906876554 1:49545037-49545059 TAATGTGACTATTAGGAGGTGGG - Intronic
907288634 1:53398150-53398172 CAGTGTAAGTATTTGCATGATGG - Intergenic
907825460 1:58012551-58012573 CAATGACAGTATTAGGAAGTGGG + Intronic
907869447 1:58430094-58430116 AAGTGATAGTATTAGGAGATGGG - Intronic
907945205 1:59129585-59129607 TAGTATTGGTATTAGGAGGTGGG + Intergenic
908211523 1:61905368-61905390 AGGTGAAGGTATTAGGAGGTAGG - Intronic
908357521 1:63337213-63337235 AAGTGATGGTATTAGGAGGTGGG + Intergenic
910093628 1:83494796-83494818 CAGTGATAGTATTAAGAAGTGGG - Intergenic
910166107 1:84329048-84329070 CAGTGAGGATATTAGGAGGTGGG + Intronic
910623277 1:89279303-89279325 AAGTGATAGTATTAAGAGGTAGG + Intergenic
912977121 1:114341033-114341055 TAGTGGCAGTATTAAGAGGTGGG - Intergenic
913082295 1:115399802-115399824 AGGTGATAGTATTAGGAGGTGGG + Intergenic
915083915 1:153371444-153371466 CAATGTGAGTATTAAGAGGTTGG - Intergenic
916598739 1:166271994-166272016 CTGTGATGGTATTAGGAGGTGGG - Intergenic
916774244 1:167943664-167943686 GAGTGGAAGAATGAGGAGGTGGG - Intronic
917284254 1:173407870-173407892 GAGTGATGGTATTAGGAGGTGGG + Intergenic
917724550 1:177816305-177816327 CAGTGATGATATTAGGAGGTGGG + Intergenic
918221236 1:182438747-182438769 CAGTGACAGTATTAAAAGGTGGG - Intergenic
918993115 1:191724036-191724058 TAGTGTAAATATCAGGAGATAGG + Intergenic
919028415 1:192206896-192206918 TGGGATAAGTATTAGGAGGTGGG - Intergenic
919365992 1:196661641-196661663 ATGTGATAGTATTAGGAGGTGGG - Intronic
919658297 1:200218495-200218517 AAGTGATAGTATTAGGATGTCGG - Intergenic
921033137 1:211351404-211351426 ATGTGACAGTATTAGGAGGTGGG - Intronic
921126489 1:212182539-212182561 GTGTGATAGTATTAGGAGGTGGG - Intergenic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
922975469 1:229780069-229780091 CAGTGATGGTATTAGGAGTTGGG + Intergenic
923965888 1:239138746-239138768 CAGTGTCAGCACTAGCAGGTTGG + Intergenic
1063392107 10:5656784-5656806 CAGTGAAGGTCCTAGGAGGTTGG - Intronic
1063781894 10:9334438-9334460 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1064347871 10:14548900-14548922 AAGTGACAGTATTTGGAGGTGGG + Intronic
1064433679 10:15292212-15292234 AGGTGAAGGTATTAGGAGGTGGG - Intronic
1064447524 10:15408811-15408833 CAGTGTGAGTTTTATGAGATTGG + Intergenic
1064548486 10:16475122-16475144 CAGTAACAGTATTAGCAGGTGGG - Intronic
1065127682 10:22589959-22589981 AAGTGATGGTATTAGGAGGTGGG + Intronic
1066566699 10:36728861-36728883 CAGTGTTGGGATTTGGAGGTGGG - Intergenic
1067512622 10:46908476-46908498 CTGTGGCAGTGTTAGGAGGTGGG + Intergenic
1067649622 10:48143346-48143368 CTGTGGCAGTGTTAGGAGGTGGG - Intergenic
1068405555 10:56584148-56584170 AAGTGTGAGTATTAGGACTTCGG + Intergenic
1068863703 10:61872270-61872292 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1068893412 10:62172390-62172412 CTGTGAAAGTTTTAGGAGGTAGG + Intergenic
1069887479 10:71633193-71633215 CAGTGGCAGTATTGAGAGGTGGG - Intronic
1070019297 10:72568105-72568127 CAGTGTCAGCATTATAAGGTAGG - Intronic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1071457677 10:85863373-85863395 AGGTGACAGTATTAGGAGGTGGG - Intronic
1072045850 10:91654122-91654144 AAGTGTGAGGATTAAGAGGTGGG - Intergenic
1072788824 10:98302971-98302993 GTGTGAAGGTATTAGGAGGTGGG - Intergenic
1073001486 10:100289202-100289224 ATGTGATAGTATTAGGAGGTGGG + Intronic
1075002261 10:118807590-118807612 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1078005644 11:7530419-7530441 AAGTGATGGTATTAGGAGGTGGG + Intronic
1078520540 11:12059659-12059681 AAGTGATGGTATTAGGAGGTAGG + Intergenic
1078824610 11:14917031-14917053 CAGTGTAAGCATTAAAAGATGGG - Intronic
1080116452 11:28626597-28626619 AAGTGAAGGTATTAGAAGGTGGG - Intergenic
1080260540 11:30345042-30345064 CAGTGATGGTATTAGGAGGTGGG - Intergenic
1080293254 11:30695533-30695555 CAGTGTGAGTTTTAGAAGTTGGG + Intergenic
1080535137 11:33214213-33214235 AAGTGACAGTGTTAGGAGGTGGG - Intergenic
1081300285 11:41443130-41443152 CAGTGTTAATATGATGAGGTTGG - Intronic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1081794961 11:45812680-45812702 AGGTGACAGTATTAGGAGGTGGG - Exonic
1084459338 11:69287441-69287463 CAGAGTGAGCATTTGGAGGTGGG - Intergenic
1085654145 11:78297004-78297026 ATGTGTTGGTATTAGGAGGTGGG - Intronic
1085664629 11:78402885-78402907 AAGTGACCGTATTAGGAGGTGGG + Intronic
1086643297 11:89186761-89186783 CAGTGTGACTATTTGGAGGTAGG + Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1087529370 11:99359386-99359408 AGGTGATAGTATTAGGAGGTGGG - Intronic
1088130935 11:106489918-106489940 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1088267918 11:108005136-108005158 CAGTGGATATTTTAGGAGGTGGG + Intergenic
1089731070 11:120519315-120519337 AAGTGATAGTATTAGGAGGTGGG + Intronic
1089883743 11:121799803-121799825 CTGTGACAGTATTAGAAGGTGGG - Intergenic
1090719114 11:129456375-129456397 CAGTGCAGGGATTTGGAGGTGGG + Intergenic
1092826474 12:12404541-12404563 CAATGACAGTAATAGGAGGTGGG - Intronic
1093012563 12:14124484-14124506 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1093021627 12:14209280-14209302 AGGTGAAGGTATTAGGAGGTAGG - Intergenic
1093480319 12:19597802-19597824 GAGTGATGGTATTAGGAGGTGGG + Intronic
1094165186 12:27436178-27436200 CTGTGATGGTATTAGGAGGTGGG - Intergenic
1095517859 12:43026984-43027006 ATGTGAAACTATTAGGAGGTAGG + Intergenic
1095775134 12:46002277-46002299 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1096070199 12:48771106-48771128 CAGTGTAAGACTGAGGAGCTGGG + Intronic
1098829895 12:75349417-75349439 CATTGTAAGTGTTAGGTGCTGGG - Intronic
1099028502 12:77495444-77495466 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1099194409 12:79598201-79598223 CAGTGCAAACATCAGGAGGTAGG + Intronic
1099230850 12:80022919-80022941 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1099506944 12:83489798-83489820 CAGTGACAGTATTCGGGGGTGGG - Intergenic
1099893552 12:88617922-88617944 GAATGTAAGCAGTAGGAGGTCGG + Intergenic
1100371657 12:93974327-93974349 GAGTGTTAGTGATAGGAGGTAGG + Intergenic
1100761605 12:97813353-97813375 CAGTGTAAGTATGTGAAGTTTGG - Intergenic
1100866805 12:98866074-98866096 AAGTGATGGTATTAGGAGGTGGG - Intronic
1101022407 12:100566509-100566531 AATTGATAGTATTAGGAGGTAGG - Intergenic
1102799448 12:115718701-115718723 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103240463 12:119409090-119409112 GAGTGTGAGTACCAGGAGGTGGG + Intronic
1103947611 12:124535269-124535291 CAGTGTCAGTGTCAGGAGGGTGG - Intronic
1105464732 13:20628012-20628034 TATTGTAAGTATTATGAGGTAGG + Intronic
1105687644 13:22801300-22801322 GTGTGTAAATATTAGGAGGCAGG - Intergenic
1106305865 13:28508738-28508760 ATGTGACAGTATTAGGAGGTGGG - Intergenic
1106678941 13:31990075-31990097 ATGTGAAGGTATTAGGAGGTAGG + Intergenic
1106905924 13:34408764-34408786 CAGTGAAAGTTTTAGCAGTTGGG + Intergenic
1108134940 13:47346011-47346033 AAATGTTGGTATTAGGAGGTTGG + Intergenic
1108259625 13:48643904-48643926 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1109682774 13:65774442-65774464 GTGTGTTAGTATTAAGAGGTGGG + Intergenic
1109702195 13:66040799-66040821 CAATGATGGTATTAGGAGGTGGG - Intergenic
1109762798 13:66852101-66852123 CAGTGTGACTATTTGGAGATAGG - Intronic
1110455593 13:75687004-75687026 ATGTGACAGTATTAGGAGGTAGG - Intronic
1110515011 13:76400439-76400461 CTGTGAGAGTATTAGAAGGTGGG + Intergenic
1110744721 13:79039049-79039071 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1110817259 13:79875891-79875913 ATGTGATAGTATTAGGAGGTAGG - Intergenic
1110966326 13:81702308-81702330 CAGTGTAATTAGTAAGTGGTAGG + Intergenic
1111889133 13:94059844-94059866 AAGTGATGGTATTAGGAGGTGGG - Intronic
1112248067 13:97752735-97752757 CTGTGACAGTATTAGGAGGCAGG + Intergenic
1112608023 13:100927189-100927211 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1112862624 13:103851290-103851312 AAGTGCAAGTGTTGGGAGGTGGG - Intergenic
1112991039 13:105514367-105514389 CTTTGAAAGTAATAGGAGGTTGG + Intergenic
1113019504 13:105868327-105868349 CAATATTAGTTTTAGGAGGTAGG + Intergenic
1113374421 13:109750926-109750948 AAGTGCTGGTATTAGGAGGTGGG + Intergenic
1113548271 13:111171791-111171813 AGGTGACAGTATTAGGAGGTGGG + Intronic
1115570411 14:34661241-34661263 AAGTGATAGTATTAGGAGATGGG + Intergenic
1115946619 14:38668545-38668567 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1115965653 14:38884669-38884691 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1115977051 14:39008249-39008271 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1116093544 14:40338387-40338409 CACTGTAAGTAATATAAGGTGGG - Intergenic
1117303653 14:54452163-54452185 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1117575779 14:57095750-57095772 CTGTGACAGTATTGGGAGGTGGG - Intergenic
1117778948 14:59212564-59212586 CAGTGGAAGGAATAGGAAGTGGG - Intronic
1118050904 14:62026562-62026584 AAGTGGTAGTATTAAGAGGTGGG - Intronic
1121151028 14:91635198-91635220 AGGTGGTAGTATTAGGAGGTGGG - Intronic
1123434094 15:20242495-20242517 CAATGTAATTATTAGGAAGTGGG + Intergenic
1124425543 15:29559684-29559706 CTGAGTCAGTAGTAGGAGGTGGG - Intronic
1124465900 15:29939676-29939698 AAGTGATGGTATTAGGAGGTGGG + Intronic
1124857756 15:33407209-33407231 CAGTGGTGGTATTAAGAGGTGGG - Intronic
1126769008 15:52036588-52036610 CAATGCAAGTGTTAGGAGGTGGG - Intronic
1127503439 15:59575928-59575950 AGGTGATAGTATTAGGAGGTTGG - Intergenic
1127839846 15:62821626-62821648 CAGAGCGACTATTAGGAGGTTGG - Intronic
1127879366 15:63142915-63142937 CATTGTGAATATTAGGAGGCAGG + Intronic
1131112060 15:89770680-89770702 CAGTGTAAGTTCTGGAAGGTGGG - Intronic
1131960410 15:97784583-97784605 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1134083180 16:11338545-11338567 ACGTGAAAGTGTTAGGAGGTAGG - Intronic
1136750043 16:32626788-32626810 TACTGTAAGTTTTAGGAGGCAGG + Intergenic
1136850518 16:33608620-33608642 CAATGTAATTATTAGGAAGTGGG - Intergenic
1137583478 16:49649410-49649432 CAGAGTAAGTCTCAGGTGGTAGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138363924 16:56456926-56456948 CAGTGGAAGTAGTAAGAAGTGGG - Intronic
1139320047 16:66107022-66107044 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1203052171 16_KI270728v1_random:885987-886009 TACTGTAAGTTTTAGGAGGCAGG + Intergenic
1203112132 16_KI270728v1_random:1457073-1457095 CAATGTAATTATTAGGAAGTGGG - Intergenic
1144235828 17:13259433-13259455 CAAGATGAGTATTAGGAGGTAGG - Intergenic
1144358602 17:14469831-14469853 CGGTGGCAGTATTAAGAGGTAGG - Intergenic
1145987355 17:29055998-29056020 CATTGTAGGTATAAGGAGGCTGG + Intronic
1147610594 17:41799657-41799679 CAGTGTATGTATTAGGGAGCAGG - Intergenic
1148545207 17:48513414-48513436 CAGTGAGAGTATAAGGGGGTGGG - Intergenic
1148801278 17:50227954-50227976 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1149301959 17:55313535-55313557 CTGTGTAAGAATGGGGAGGTGGG + Intronic
1149561535 17:57611212-57611234 AAGGGGAAGTCTTAGGAGGTGGG + Intronic
1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG + Intergenic
1151099171 17:71536123-71536145 GAGTGTGAATATTAGGAGGTGGG - Intergenic
1151106668 17:71623633-71623655 CTGTGATGGTATTAGGAGGTAGG - Intergenic
1151265199 17:72949679-72949701 CAGTGATTGTATTAGGAGGTGGG - Intronic
1153724957 18:7944956-7944978 CAGTGTCATTATTGAGAGGTGGG + Intronic
1155121384 18:22823353-22823375 GACTGTAAGTATCAAGAGGTGGG + Intronic
1155343933 18:24839992-24840014 AGGTGGTAGTATTAGGAGGTGGG + Intergenic
1157532999 18:48438217-48438239 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1157637779 18:49178033-49178055 CGGTTTATGTATTAAGAGGTTGG - Intronic
1157741138 18:50094340-50094362 CAGTGTAACTCTGAGCAGGTGGG + Intronic
1158079142 18:53567822-53567844 CATTGATAGTATTTGGAGGTAGG - Intergenic
1158259643 18:55592527-55592549 ATGTGCTAGTATTAGGAGGTGGG - Intronic
1158388835 18:57026472-57026494 GAGTGAAGGTATTAGTAGGTGGG + Intronic
1158727545 18:59987272-59987294 GAGTGACAGTATTTGGAGGTGGG + Intergenic
1158826210 18:61223028-61223050 CAGTAACAGTATTAAGAGGTGGG - Intergenic
1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG + Intergenic
1159820212 18:73131592-73131614 CAATGTGAGTATTCGAAGGTAGG - Intergenic
1162163569 19:8737538-8737560 ATGTGAAGGTATTAGGAGGTGGG + Intergenic
1162165035 19:8746751-8746773 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162166101 19:8754202-8754224 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162167167 19:8761658-8761680 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162169176 19:8775414-8775436 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162169856 19:8780725-8780747 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1164529414 19:29036806-29036828 CAGTGGCAGCATTAGGTGGTTGG - Intergenic
1165030316 19:32993613-32993635 CAATGTAATTATTAGGAAGTGGG + Intronic
1165124865 19:33586794-33586816 CAGTGCAAGTGTTCAGAGGTGGG + Intergenic
1165652743 19:37505697-37505719 GAGTGTGAATAGTAGGAGGTAGG + Intergenic
1165968683 19:39606462-39606484 TAGTACAAGTATTGGGAGGTTGG - Intronic
1165974154 19:39659637-39659659 CAATGTAAGTATTGGGAGGTTGG - Intronic
1168443903 19:56395481-56395503 GAGTATAAGTACTAGGAGGCAGG + Intergenic
1168519117 19:57034566-57034588 AGGTGGAGGTATTAGGAGGTGGG + Intergenic
925038463 2:710577-710599 AAGTGATGGTATTAGGAGGTGGG + Intergenic
925833815 2:7923223-7923245 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
927218302 2:20682727-20682749 CAATGCAACTATTGGGAGGTGGG - Intergenic
927629998 2:24764855-24764877 CAGTCTAAGCATTAGGAAATAGG + Intronic
928168073 2:28985079-28985101 ATGTGTTGGTATTAGGAGGTGGG + Intronic
928717851 2:34083408-34083430 CTGTGATAGTATTAAGAGGTTGG - Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
932269092 2:70393289-70393311 CATTGCAAGTATTAAGAGGTGGG + Intergenic
932727019 2:74188332-74188354 CAGTGGAAGTGTGAGGAGGGTGG - Intergenic
933057418 2:77689544-77689566 GGGTGATAGTATTAGGAGGTGGG + Intergenic
933290880 2:80436958-80436980 GAGTGATAGTATTAAGAGGTGGG + Intronic
933927556 2:87110734-87110756 GGGTGATAGTATTAGGAGGTGGG + Intergenic
933993774 2:87652573-87652595 CAGTGAGGGCATTAGGAGGTGGG - Intergenic
935063656 2:99629899-99629921 ATGTGATAGTATTAGGAGGTGGG - Intronic
935685291 2:105677660-105677682 ATGTGATAGTATTAGGAGGTGGG + Intergenic
935740668 2:106144838-106144860 CAGTGATGGTATTAGGAGGTGGG - Intronic
936300089 2:111298310-111298332 CAGTGAGGGCATTAGGAGGTGGG + Intergenic
936773622 2:115945278-115945300 CATTGATAGTATTTGGAGGTGGG - Intergenic
938928661 2:136066912-136066934 AAGTGATGGTATTAGGAGGTGGG + Intergenic
939210159 2:139164301-139164323 CTGTGAAGGTATTAGAAGGTGGG + Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
940285544 2:152029675-152029697 CGGTGATGGTATTAGGAGGTGGG + Intronic
940307228 2:152239571-152239593 AAGTGATCGTATTAGGAGGTAGG + Intergenic
940411420 2:153368200-153368222 AAGTGGTGGTATTAGGAGGTGGG + Intergenic
940718579 2:157257114-157257136 ATGTGATAGTATTAGGAGGTAGG - Intergenic
941836000 2:170021550-170021572 CAAGGTTAGTATAAGGAGGTGGG - Intronic
942225082 2:173807922-173807944 AGGTGATAGTATTAGGAGGTGGG - Intergenic
942287349 2:174433574-174433596 ATGTGTTAGTATTAGGAGGTAGG + Exonic
942650218 2:178158524-178158546 AAGTGATAGTATTTGGAGGTGGG - Intergenic
943295675 2:186135154-186135176 TAGTGTAATTTTTAGGAGTTGGG + Intergenic
943475580 2:188351033-188351055 CAATGTAAGTATTAGGACTATGG + Intronic
943660107 2:190550417-190550439 AGGTGATAGTATTAGGAGGTAGG - Intergenic
944965467 2:204927241-204927263 AGGTGTTAGTATTAAGAGGTAGG + Intronic
945007799 2:205428019-205428041 GCGTGATAGTATTAGGAGGTGGG + Intronic
945935202 2:215896873-215896895 CAGTGATGGTATTAGGAGGTGGG - Intergenic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946856452 2:223954820-223954842 GGGTGTAAGTACCAGGAGGTGGG + Intergenic
947485217 2:230541756-230541778 CTGTGAAGGTACTAGGAGGTGGG - Intronic
948036313 2:234861100-234861122 CTGTGAAAGTATTAAGGGGTGGG - Intergenic
948439346 2:237976715-237976737 CTGTGGTAGTATTAAGAGGTGGG - Intronic
1170147986 20:13198471-13198493 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1170309173 20:14974238-14974260 CAGTGGCAGTATTGAGAGGTGGG - Intronic
1170722748 20:18898198-18898220 CTGTGATGGTATTAGGAGGTGGG + Intergenic
1171394820 20:24825221-24825243 AAGTGAGAGTATTAAGAGGTGGG - Intergenic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1171510572 20:25680779-25680801 CAGTGCAGGTATGAGAAGGTGGG - Intronic
1172582477 20:36059224-36059246 CAGTGATGGTATTAAGAGGTGGG - Intergenic
1174623483 20:51894988-51895010 GAGTGACAGTATTAAGAGGTGGG + Intergenic
1177977156 21:27865903-27865925 CATTGTAAGTTTAAAGAGGTAGG + Intergenic
1178222863 21:30680887-30680909 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1178694018 21:34777641-34777663 CAAAGTGAGTATCAGGAGGTGGG + Intergenic
1178750439 21:35297406-35297428 ATGTGACAGTATTAGGAGGTGGG + Intronic
1179344278 21:40542457-40542479 CTGTGATTGTATTAGGAGGTGGG + Intronic
1180010397 21:45046191-45046213 AGGTGGTAGTATTAGGAGGTGGG - Intergenic
1182817625 22:33179887-33179909 CTGTGACAGTATTAAGAGGTGGG + Intronic
1183174686 22:36214150-36214172 CAGTGTAGGTATCAGGAACTTGG + Intergenic
1184274552 22:43402782-43402804 GAGTGGAAGTATGTGGAGGTTGG + Intergenic
949170820 3:994397-994419 CAGTGATGGTATTAAGAGGTGGG + Intergenic
949196363 3:1313977-1313999 AGGTGATAGTATTAGGAGGTGGG - Intronic
951425469 3:22539647-22539669 AAGTGATAGTATTAGGAGGTTGG - Intergenic
953408580 3:42673627-42673649 GTGTGATAGTATTAGGAGGTAGG - Intergenic
953950466 3:47185499-47185521 AAGTGATAGTATTAGGAAGTAGG - Intergenic
954409984 3:50366328-50366350 CAGAGTAAGTCCTAGGAGGAAGG + Exonic
954643370 3:52115575-52115597 AAGTAATAGTATTAGGAGGTGGG + Intronic
954895223 3:53969524-53969546 AGGTGATAGTATTAGGAGGTGGG - Intergenic
955380689 3:58435461-58435483 CAGTGTAAGTGCCAGGAGCTGGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956582129 3:70825853-70825875 AAGTGATAGTATTAGGAGGTGGG + Intergenic
956860292 3:73316626-73316648 CAGTTTAAGACTTAGGAGATTGG - Intergenic
957940459 3:86996630-86996652 CAATGTAATCATTATGAGGTGGG + Intergenic
958891321 3:99786300-99786322 AAGTGATGGTATTAGGAGGTGGG + Intronic
959123760 3:102265336-102265358 ATGTGATAGTATTAGGAGGTGGG + Intronic
959141685 3:102493618-102493640 AAGTGATAGTATTAAGAGGTAGG + Intergenic
959524338 3:107359941-107359963 AAGTGATGGTATTAGGAGGTAGG + Intergenic
959638172 3:108599670-108599692 ATGTGATAGTATTAGGAGGTTGG + Intronic
959795421 3:110422186-110422208 CAGTGGAAGTTTTGGGAGGTGGG + Intergenic
959823279 3:110762677-110762699 CTGTGATAGTATTAGAAGGTGGG - Intergenic
960157369 3:114309489-114309511 CAGTCTAAGTCTTAGGAAGCAGG - Exonic
960268323 3:115647075-115647097 CTGAGATAGTATTAGGAGGTGGG + Intronic
960461145 3:117937477-117937499 CAGTGATGGTATTAAGAGGTAGG + Intergenic
960694835 3:120386032-120386054 AAGTTATAGTATTAGGAGGTGGG + Intergenic
962083500 3:132165794-132165816 CATTCTAAGTGTTAGGAAGTGGG - Intronic
962107568 3:132407965-132407987 AGGTGATAGTATTAGGAGGTTGG + Intergenic
962850317 3:139303560-139303582 CTGTGATAGTATTTGGAGGTAGG - Intronic
962948032 3:140190139-140190161 AGGTGATAGTATTAGGAGGTGGG - Intronic
963334353 3:143955863-143955885 AAGTGATAGTATTAGGTGGTGGG - Intergenic
963908358 3:150793008-150793030 CTGTGATAATATTAGGAGGTGGG - Intergenic
964340850 3:155706985-155707007 ATGTGATAGTATTAGGAGGTGGG + Intronic
966059832 3:175741390-175741412 AAGTGATGGTATTAGGAGGTAGG - Intronic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
966375674 3:179292950-179292972 CAGTGTAAGTTTTTGGGAGTGGG - Intergenic
966393339 3:179475886-179475908 CTGTGACAGTATTAAGAGGTGGG - Intergenic
966453311 3:180086594-180086616 CAATGTGAGTATTAGGAGATGGG + Intergenic
967013130 3:185457591-185457613 AAGGGACAGTATTAGGAGGTGGG - Intronic
968840032 4:2996583-2996605 CTGTGACAGTATTGGGAGGTAGG - Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969391776 4:6896163-6896185 CTGTGCTAGTGTTAGGAGGTTGG + Intergenic
969950388 4:10829630-10829652 CAGTGACAGTATTAGGAAGTGGG + Intergenic
970113016 4:12659882-12659904 AGGTGATAGTATTAGGAGGTAGG - Intergenic
970730980 4:19103258-19103280 AGGTGATAGTATTAGGAGGTGGG + Intergenic
970866262 4:20762305-20762327 ATGTGATAGTATTAGGAGGTGGG - Intronic
971152194 4:24045070-24045092 CTGTGTAAGAATTAGGATGTAGG - Intergenic
971485793 4:27158888-27158910 ACGTGAAAGTATTAGGAGGTGGG + Intergenic
971907458 4:32745641-32745663 GTGTGATAGTATTAGGAGGTGGG - Intergenic
973911612 4:55587339-55587361 ATGTGATAGTATTAGGAGGTGGG - Intronic
974008662 4:56586480-56586502 CAGTGATTGAATTAGGAGGTGGG - Intronic
974416524 4:61614429-61614451 CAGTGAAAGTATTTGAAGGAGGG - Intronic
974758234 4:66241171-66241193 AAGTGTAATTATTAGGATGAAGG + Intergenic
975233362 4:71961015-71961037 CAATGTGATGATTAGGAGGTGGG + Intergenic
975236849 4:72008669-72008691 CATTTTTAGTATGAGGAGGTTGG + Intergenic
975309377 4:72885246-72885268 TAATATTAGTATTAGGAGGTGGG + Intergenic
975531846 4:75407572-75407594 AAGTGATAGTATTAGGAGGTAGG - Intergenic
976224828 4:82787640-82787662 AGGTGTTGGTATTAGGAGGTGGG + Intronic
976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG + Intergenic
976305174 4:83552802-83552824 AAGTGATGGTATTAGGAGGTGGG + Intronic
978161795 4:105557515-105557537 ATGTGACAGTATTAGGAGGTGGG + Intronic
978417710 4:108494874-108494896 CAATGTAATTATTGGTAGGTAGG - Intergenic
978631894 4:110757217-110757239 AGGTGATAGTATTAGGAGGTGGG + Intergenic
979098082 4:116576039-116576061 GTGTGAAAGTATTAGAAGGTGGG + Intergenic
979348021 4:119612131-119612153 AGGTGATAGTATTAGGAGGTGGG + Intronic
980206700 4:129729018-129729040 ATGTGCTAGTATTAGGAGGTAGG + Intergenic
980524380 4:133970691-133970713 AGGTGGTAGTATTAGGAGGTAGG + Intergenic
980706519 4:136503438-136503460 AGGTGATAGTATTAGGAGGTGGG + Intergenic
981047477 4:140278651-140278673 CAGTGATAGTATTAGAAGGTAGG - Intronic
981593084 4:146387084-146387106 ATGTGAAAGTATTTGGAGGTGGG + Intronic
981665114 4:147215444-147215466 AAGTGATGGTATTAGGAGGTGGG + Intergenic
981703946 4:147639975-147639997 CAGTGTGGGGATTAGGAGGCAGG - Intronic
982331290 4:154184660-154184682 CTGTGGCAGTATTAAGAGGTAGG + Intergenic
982962468 4:161858042-161858064 AGGTGATAGTATTAGGAGGTGGG + Intronic
983000214 4:162405162-162405184 ATGTGACAGTATTAGGAGGTAGG - Intergenic
984178173 4:176446102-176446124 CAATGTTGGTATTAAGAGGTGGG + Intergenic
984281130 4:177672089-177672111 AAGTGATAGTATTAGGAAGTGGG - Intergenic
986020823 5:3800548-3800570 AAATGAAGGTATTAGGAGGTGGG - Intergenic
986340101 5:6781516-6781538 CAATGGCAGTATTAAGAGGTGGG + Intergenic
986915649 5:12616402-12616424 AAGTGATAGTGTTAGGAGGTGGG + Intergenic
987033352 5:13996220-13996242 CAATAATAGTATTAGGAGGTGGG - Intergenic
987803230 5:22725671-22725693 GTGTGGCAGTATTAGGAGGTAGG - Intronic
988123240 5:26994386-26994408 GACTGATAGTATTAGGAGGTGGG + Intronic
988172398 5:27675710-27675732 AAGTGATGGTATTAGGAGGTGGG + Intergenic
989025825 5:37067000-37067022 CAGAGTAATTTTTAGGAAGTAGG + Intergenic
989381348 5:40812465-40812487 ATGTGATAGTATTAGGAGGTGGG - Intergenic
989439565 5:41454535-41454557 GGGTGAAAGTATTAGAAGGTGGG - Intronic
990362677 5:55037101-55037123 CAGTGTGACTGTTTGGAGGTGGG + Intergenic
990377233 5:55183669-55183691 AGGTGATAGTATTAGGAGGTGGG - Intergenic
990924222 5:61001245-61001267 AAGTAAAAGTATAAGGAGGTTGG - Intronic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
993107240 5:83613082-83613104 CAATGTAATAATTAAGAGGTGGG + Intergenic
993488492 5:88516199-88516221 AAGTGATAGTATTAAGAGGTCGG - Intergenic
993747983 5:91625582-91625604 AGGTGACAGTATTAGGAGGTGGG + Intergenic
994369108 5:98948707-98948729 AGGTGATAGTATTAGGAGGTGGG - Intergenic
994755944 5:103793031-103793053 ATGTGTAAGTATTAGGCAGTGGG + Intergenic
994834713 5:104834916-104834938 TAGTGCAAGTTTTTGGAGGTTGG - Intergenic
995065002 5:107851582-107851604 AAGTGATGGTATTAGGAGGTGGG + Intergenic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
995247577 5:109951918-109951940 ATGTGAAAGTATTCGGAGGTGGG + Intergenic
995855054 5:116582414-116582436 AAGTCTAAATATTAGTAGGTGGG - Intergenic
997372843 5:133373002-133373024 ACGTGAAGGTATTAGGAGGTGGG + Intronic
998826778 5:146109621-146109643 CGGTGTTGGTATTAAGAGGTGGG - Intergenic
999969513 5:156845157-156845179 AAGTGTTAGTATTTGGAGATGGG + Intergenic
999990635 5:157046899-157046921 CAATGCAAGTATTAAGAGCTGGG - Intronic
1000738897 5:164939678-164939700 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1001677242 5:173528764-173528786 AGGTGACAGTATTAGGAGGTGGG + Intergenic
1001738065 5:174023247-174023269 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1001867986 5:175122244-175122266 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1002915423 6:1524606-1524628 AAGTGATAGTCTTAGGAGGTGGG - Intergenic
1003311006 6:4969973-4969995 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1003709703 6:8575724-8575746 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1003794887 6:9590080-9590102 CAATGATAGTATTAGAAGGTGGG - Intergenic
1004281066 6:14280374-14280396 CTGTGCTGGTATTAGGAGGTGGG - Intergenic
1004759805 6:18654228-18654250 ATGTGTTGGTATTAGGAGGTGGG + Intergenic
1005129726 6:22492271-22492293 GTGTGATAGTATTAGGAGGTAGG + Intergenic
1005660240 6:27990863-27990885 AAGTGTTGGTATTAGGAGATGGG - Intergenic
1006433230 6:34011170-34011192 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
1008252577 6:49258481-49258503 AGGTGATAGTATTAGGAGGTAGG - Intergenic
1008385525 6:50885494-50885516 CTGAGTATGGATTAGGAGGTAGG + Intergenic
1008774353 6:55018257-55018279 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1009041783 6:58188989-58189011 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1009217632 6:60943252-60943274 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1010185728 6:73141288-73141310 AAGTGATAGTATTAAGAGGTGGG - Intronic
1010290585 6:74132403-74132425 CAGTGATGGTATCAGGAGGTGGG + Intergenic
1011747474 6:90420061-90420083 AAGTGTGAGAATTAGGGGGTGGG - Intergenic
1012328058 6:97948656-97948678 CAGTGAAAATCTTAGGAGGCTGG + Intergenic
1012555954 6:100511754-100511776 CAGTGTAAGTATTAACTGATTGG - Intronic
1012778870 6:103531456-103531478 CTGTGGCAGTGTTAGGAGGTGGG + Intergenic
1013991329 6:116257626-116257648 CAGTCTAAGAATCAGGATGTAGG - Intronic
1014885991 6:126781893-126781915 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1015869206 6:137759226-137759248 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1016105157 6:140153054-140153076 CTGTGTGAGAATTAGGATGTTGG + Intergenic
1016263736 6:142207219-142207241 CAGTGTAGAAATTATGAGGTGGG - Intronic
1016460088 6:144272825-144272847 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1017357123 6:153522954-153522976 CTCTGTAAGGATTAGGAGATGGG - Intergenic
1018303648 6:162430406-162430428 TAGTGCATGGATTAGGAGGTGGG - Intronic
1018494510 6:164336388-164336410 TAGTGATAGTATTAGGAGGCGGG + Intergenic
1018645661 6:165945489-165945511 AGGTGATAGTATTAGGAGGTGGG + Intronic
1024566558 7:50686141-50686163 CAGTGAAGGTATTAGGAGGTGGG + Intronic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1025887909 7:65615691-65615713 GTGTGAAAGTATTAGGAGATGGG - Intergenic
1027547191 7:79542357-79542379 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1027672389 7:81118061-81118083 AGGTGAGAGTATTAGGAGGTGGG - Intergenic
1027735686 7:81930365-81930387 CGGTGACGGTATTAGGAGGTAGG + Intergenic
1028073306 7:86479054-86479076 TAGTGTAAATATTAGGAAGTGGG - Intergenic
1030318614 7:108141587-108141609 CTGTGATGGTATTAGGAGGTAGG + Intergenic
1030424523 7:109357352-109357374 AAGTGATAGTATTAAGAGGTGGG + Intergenic
1031217796 7:118919895-118919917 CACTGAAAGGAGTAGGAGGTTGG + Intergenic
1031854480 7:126906047-126906069 GTGTGAAAGTATTAGGAGATGGG + Intronic
1033079791 7:138284640-138284662 AGGTGAAGGTATTAGGAGGTGGG + Intergenic
1033625037 7:143101987-143102009 AAGTGATAGTATTAAGAGGTAGG - Intergenic
1035640014 8:1177848-1177870 CAGTGGTGGTATTATGAGGTGGG - Intergenic
1035830358 8:2688624-2688646 AAGTGTTGGTATTAGGAGGCTGG - Intergenic
1035931713 8:3786891-3786913 AGGTGCTAGTATTAGGAGGTGGG - Intronic
1036175098 8:6530135-6530157 CAGTGTTAGTATCAAAAGGTGGG + Intronic
1037086888 8:14863172-14863194 CAGTGAAAGGATTAAGAGTTTGG - Intronic
1037143647 8:15547651-15547673 GTGAGAAAGTATTAGGAGGTGGG + Intronic
1037315823 8:17598571-17598593 CACTGCATGTATTGGGAGGTAGG + Intronic
1038282872 8:26181733-26181755 AGGTGACAGTATTAGGAGGTGGG + Intergenic
1038559522 8:28559852-28559874 CAGAGTGAGTATTGGGAAGTGGG - Intronic
1038699595 8:29837176-29837198 GAGTCTAAGTATGAGGAGGAAGG + Intergenic
1038854544 8:31317186-31317208 ATGTGATAGTATTAGGAGGTAGG + Intergenic
1038984438 8:32793214-32793236 AAGTGAAAGCATTAAGAGGTAGG - Intergenic
1040588535 8:48766981-48767003 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041790784 8:61694099-61694121 CAGTTTGAGTATGAGGAGGTAGG - Intronic
1042423907 8:68623836-68623858 ATGTGAAGGTATTAGGAGGTGGG - Intronic
1042966100 8:74354230-74354252 CACTGTAAGTACCATGAGGTTGG + Intronic
1043065549 8:75566298-75566320 GAGTGATGGTATTAGGAGGTGGG - Exonic
1044791646 8:95853512-95853534 AAGTAATAGTATTAGGAGGTGGG - Intergenic
1045080974 8:98625533-98625555 CAGTGGAAGTTTTAATAGGTGGG - Intronic
1045558269 8:103235991-103236013 CATTGTGAGTAGTAGGAGCTGGG + Intergenic
1045766908 8:105683143-105683165 AAGTAATAGTATTAGGAGGTAGG - Intronic
1046332709 8:112741558-112741580 AGGTGATAGTATTAGGAGGTGGG - Intronic
1046616307 8:116481293-116481315 CTGTGACGGTATTAGGAGGTGGG - Intergenic
1047299555 8:123601415-123601437 CAGTGTATGTATTTGTAGGTGGG + Intergenic
1048145689 8:131840577-131840599 TAGTTTAAGTAGTAGGAAGTTGG - Intergenic
1048206573 8:132420236-132420258 GTGTGATAGTATTAGGAGGTGGG - Intronic
1048934515 8:139343921-139343943 CAGTTTCTGAATTAGGAGGTGGG - Intergenic
1049381755 8:142319730-142319752 CAGGGTGGGTATCAGGAGGTGGG - Intronic
1050640445 9:7661775-7661797 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1050755431 9:8996788-8996810 AAGTAAAAGTATTAAGAGGTAGG - Intronic
1051211744 9:14752282-14752304 AAGTGAAAGGATTAGGAGGGAGG + Intronic
1051811725 9:21056957-21056979 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1052074300 9:24121725-24121747 GGGTGATAGTATTAGGAGGTGGG + Intergenic
1052970742 9:34376019-34376041 CAGTGTAAGTTTTAGGAGATGGG + Intronic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1055824835 9:80311526-80311548 CAGTGATAGTATTAAGAGGTGGG + Intergenic
1056485648 9:87054574-87054596 AGGTGACAGTATTAGGAGGTGGG - Intergenic
1056526963 9:87452385-87452407 CGGTGATGGTATTAGGAGGTAGG + Intergenic
1056700417 9:88901086-88901108 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1057057725 9:91976838-91976860 GTGTGAAAGTATTAAGAGGTGGG + Intergenic
1058048243 9:100380333-100380355 ATGTGACAGTATTAGGAGGTGGG - Intergenic
1058116727 9:101092786-101092808 CTGTGATGGTATTAGGAGGTGGG + Intronic
1058439397 9:104993233-104993255 CAGTATGATGATTAGGAGGTGGG - Intergenic
1059288689 9:113201489-113201511 GTGTGACAGTATTAGGAGGTGGG + Intronic
1059494946 9:114701748-114701770 CAGTGAAAGTAGTGGGAGGTGGG - Intergenic
1185869653 X:3653145-3653167 AAGTGATAGGATTAGGAGGTGGG + Intronic
1185936383 X:4261830-4261852 ATGTATTAGTATTAGGAGGTGGG + Intergenic
1186082806 X:5951791-5951813 CTGTGTAGGTATTTGGAAGTGGG - Intronic
1186274997 X:7928850-7928872 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1186408731 X:9327031-9327053 AGGTGAGAGTATTAGGAGGTGGG + Intergenic
1186725723 X:12356463-12356485 AAGTGATGGTATTAGGAGGTGGG + Intronic
1186835516 X:13433554-13433576 CAGTGCAAGTGTTGTGAGGTGGG - Intergenic
1186836221 X:13441122-13441144 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1187664277 X:21586806-21586828 CAGTGAAAGAATTAGGAAATTGG + Intronic
1188678146 X:32968641-32968663 AAGTGATAGTATTAGGAGATGGG + Intronic
1189074174 X:37898270-37898292 ATGTGATAGTATTAGGAGGTGGG - Intronic
1189187994 X:39070465-39070487 CAATGTAAGTCTTATAAGGTTGG - Intergenic
1189668664 X:43384525-43384547 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1195069804 X:101267871-101267893 ATGTGTTAGTATTAAGAGGTAGG + Intergenic
1195805680 X:108762889-108762911 CAGTGCAACTGTTGGGAGGTTGG - Intergenic
1196081974 X:111642175-111642197 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1196822978 X:119718155-119718177 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1198012827 X:132576265-132576287 CAGAGAAAGTATTGGGAGGGAGG + Intergenic
1198300777 X:135332357-135332379 AGGTGATAGTATTAGGAGGTGGG + Intronic
1198984972 X:142440751-142440773 CAGTGACAGTTTTAGGAGGTGGG + Intergenic
1199156689 X:144557529-144557551 AAAGGTTAGTATTAGGAGGTGGG - Intergenic
1201512487 Y:14780506-14780528 CTGTGTAGGTATTTGGAAGTGGG + Intronic
1201594503 Y:15652613-15652635 CAGGGTAGGTACTAGGAGGTGGG + Intergenic
1201601657 Y:15736143-15736165 TAGAGTAAGGATTAGGAAGTTGG + Intergenic