ID: 1171518114

View in Genome Browser
Species Human (GRCh38)
Location 20:25754748-25754770
Sequence TATTATCTTTAGAAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171518112_1171518114 7 Left 1171518112 20:25754718-25754740 CCCACTGGGGCTATTAAGGTAGT No data
Right 1171518114 20:25754748-25754770 TATTATCTTTAGAAGTTTTATGG No data
1171518113_1171518114 6 Left 1171518113 20:25754719-25754741 CCACTGGGGCTATTAAGGTAGTC No data
Right 1171518114 20:25754748-25754770 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171518114 Original CRISPR TATTATCTTTAGAAGTTTTA TGG Intergenic
No off target data available for this crispr