ID: 1171520090

View in Genome Browser
Species Human (GRCh38)
Location 20:25769157-25769179
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 6, 1: 0, 2: 1, 3: 7, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG + Intronic
901218431 1:7567728-7567750 GATGCTGGGGTGATTCAGATGGG + Intronic
901838067 1:11936957-11936979 GCCACTAGGGAGATTGAGGCAGG - Intronic
902076679 1:13792656-13792678 GACACTTTGATGATTCAGATTGG - Intronic
906249758 1:44301872-44301894 GGAGCTAGGTTGATTCAGACTGG + Intronic
910381867 1:86635323-86635345 GAGATTAAGGTGATTAAGACTGG - Intergenic
910835302 1:91502296-91502318 GACCTTAGGGTGAATAAGACAGG + Intronic
911422510 1:97662110-97662132 GCTACTAGGGAGATTGAGACAGG - Intronic
913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG + Intronic
917321779 1:173789833-173789855 GAAATTAAGGTCATTCAGACTGG + Intergenic
918062081 1:181070675-181070697 GATACTAGGGTCATTCAAACTGG - Intergenic
924054088 1:240107905-240107927 GACACTAGGGATATTGAGAAGGG - Intronic
924387168 1:243509743-243509765 GAAAATAGGGTGATTCAAATTGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067290109 10:44934107-44934129 GGCACTGGGGAGATTCAGAAGGG - Intronic
1073866083 10:107805566-107805588 GAGACTTGGGAGATTCAAACTGG + Intergenic
1074556378 10:114494762-114494784 GACACTAGGGTAAGTCTGATTGG + Intronic
1075562846 10:123480898-123480920 GGAACTAGCGTGACTCAGACTGG + Intergenic
1075983334 10:126760572-126760594 CAAACTATGGTTATTCAGACTGG + Intergenic
1078215233 11:9306325-9306347 CATAATAGGGTAATTCAGACTGG - Intronic
1080340911 11:31262805-31262827 GTGACTAGGGTGCTACAGACTGG + Exonic
1080610397 11:33899205-33899227 GACACAGGGGTGAATAAGACAGG - Intergenic
1085036048 11:73300722-73300744 GGCAATAGGGTCATTCAGAGAGG + Intergenic
1090672135 11:128955902-128955924 GAAACTTGGATGATTCTGACTGG + Intergenic
1091390069 12:120796-120818 GACATTAGGCTGATACACACAGG - Intronic
1091615108 12:2044833-2044855 GAGACTAGGGTTATGCAGCCAGG - Intronic
1092664406 12:10779387-10779409 GACCCTGGGGTGATTAGGACAGG + Intergenic
1093057381 12:14568309-14568331 CACAGGAGAGTGATTCAGACGGG + Exonic
1100785929 12:98078181-98078203 GTCATTAGGGTGAATCAGAAAGG - Intergenic
1104889556 12:132133745-132133767 GACTCTAGGGCGAGTCGGACGGG - Intergenic
1110144954 13:72179130-72179152 AACATTAGTGTGTTTCAGACAGG + Intergenic
1112061465 13:95743667-95743689 GCCACTAGGGAGACTGAGACAGG - Intronic
1118045733 14:61968983-61969005 GCCACTAGGTTGATTCAGTAAGG + Intergenic
1118578769 14:67272085-67272107 GATACTATGGTTATTAAGACAGG - Intronic
1119489301 14:75016972-75016994 GACACTGGGCTGATTCAGTCAGG + Exonic
1121446551 14:93982543-93982565 TTCCCAAGGGTGATTCAGACAGG - Intergenic
1121599822 14:95195104-95195126 GCCACAGGGGTGATTCAGGCGGG - Intronic
1129801636 15:78419312-78419334 GACACGAGGCTGACCCAGACAGG + Intergenic
1131438769 15:92442959-92442981 GACAGGAGGGTGATTAAAACTGG + Intronic
1138919346 16:61508287-61508309 GACACTAGGGACATTCAAAGAGG + Intergenic
1142845848 17:2675727-2675749 GCCACTAGGGAGACTGAGACAGG + Intronic
1144955942 17:19018865-19018887 GACACTAGGATTTTTCACACTGG - Intronic
1145013758 17:19384054-19384076 CACACTAGGGTGGCCCAGACAGG + Exonic
1150999432 17:70357416-70357438 TACACTAGGGTGAGTCAGCTAGG - Intergenic
1151231015 17:72685139-72685161 GACACAGGGGTGAATGAGACAGG + Intronic
1162617005 19:11810128-11810150 GACTCTAGGGGGTTTCAAACAGG - Intergenic
1162992163 19:14310615-14310637 GACTCTGGGGTGATTTAGGCAGG - Intergenic
1163323305 19:16587150-16587172 GACACACGGGTGAATCAAACAGG + Intronic
1166831699 19:45643339-45643361 GACCCAAGGGAGATGCAGACCGG + Intronic
927649310 2:24902190-24902212 GACACTAGGGAGACTGAGGCAGG - Intronic
929027640 2:37620029-37620051 GCCACTAGGGTGATTAAGGGTGG - Intergenic
933418061 2:82012552-82012574 GACACTAGTTTCATTCAGAAGGG - Intergenic
935815896 2:106845456-106845478 GAAAGTAGGGTGATTCTGAGGGG + Intronic
938627384 2:133125770-133125792 GCAATGAGGGTGATTCAGACAGG - Intronic
939507847 2:143071386-143071408 GACACTTGGGTGAGTCAGATGGG + Intergenic
945286315 2:208086252-208086274 CTCACAAGGATGATTCAGACAGG - Intergenic
946045961 2:216821176-216821198 GACACATGGGTGATTCTGAGGGG + Intergenic
1171520090 20:25769157-25769179 GACACTAGGGTGATTCAGACAGG + Intronic
1171556829 20:26087336-26087358 GACACTAGGGTGATTCAGACAGG - Intergenic
1172583689 20:36067292-36067314 GATACTTGGGAGACTCAGACAGG + Intergenic
1172744066 20:37193167-37193189 GAGATTAGGGTGATGCAGAGAGG - Intronic
1176654222 21:9575433-9575455 GACACTAGGGTGATTCAGACAGG + Intergenic
1177712556 21:24797890-24797912 TACACTGGGGTGATTCAGAAAGG - Intergenic
953002183 3:38946040-38946062 GACACTAGGAAGTTTTAGACAGG - Intronic
955762994 3:62309196-62309218 AACACTACGTTGATTCAGAAAGG + Intergenic
957778693 3:84790057-84790079 GACAATAGGGTTAATAAGACAGG + Intergenic
966170296 3:177072723-177072745 GACAATATAGTTATTCAGACTGG + Intronic
981422039 4:144562276-144562298 GACTTCAGGGGGATTCAGACAGG + Intergenic
982891796 4:160863429-160863451 GATACTAGGTTGATGAAGACGGG - Intergenic
984572981 4:181415543-181415565 AACGCTAGGGTGATTGAGAAAGG - Intergenic
987600031 5:20056114-20056136 GCTACTAGGGTGGTTGAGACAGG - Intronic
993512633 5:88790441-88790463 GATACTCTGGTGATTCACACTGG + Intronic
997969339 5:138387750-138387772 GACACTATGATGATTTACACTGG - Intronic
1001356009 5:171023080-171023102 GAGACTAGTGTGATCCAGAGAGG - Intronic
1010777685 6:79905984-79906006 GAGACTGGGGTGATGCAGTCGGG - Intergenic
1012584388 6:100904521-100904543 GCCAGTAGTGTGATTCAGTCTGG - Intergenic
1014597432 6:123362100-123362122 GACAATAGCGTTCTTCAGACTGG - Intronic
1017438329 6:154439060-154439082 GACACTTGAGTAATTCAGCCAGG - Intronic
1017542994 6:155422217-155422239 GACAAAAGGGAGATTCAGAGCGG + Intronic
1023264318 7:38390498-38390520 GACAGTAGAGTGATTCAGACTGG - Intronic
1025280573 7:57624101-57624123 GACACTAGGGTGATTCAGACAGG + Intergenic
1025304157 7:57841406-57841428 GACACTAGGGTGATTCAGACAGG - Intergenic
1027765507 7:82335906-82335928 GACACTAAGGTGAGCCAGAAAGG - Intronic
1028360220 7:89957716-89957738 GCCACTAGGGAGATTGAGACAGG + Intergenic
1032177750 7:129646457-129646479 GACACTGGGGTAATCCAGATAGG + Intronic
1034699998 7:153087706-153087728 GCCAATTGGGTGATTCACACTGG + Intergenic
1035271752 7:157723991-157724013 TACACCAGCGCGATTCAGACGGG - Intronic
1036793649 8:11740239-11740261 GACACTAGGGAGACACAGAGAGG + Intronic
1043276692 8:78405469-78405491 GACACAAGGTAGATTCAGATTGG - Intergenic
1044898662 8:96920743-96920765 GACACTAGGGGCATGCAGAGGGG + Intronic
1051608842 9:18942326-18942348 GAGACAAGGGTGAGTCAGGCAGG - Intronic
1059072150 9:111149173-111149195 GGCACTAGGGGGAGTCAGGCTGG - Intergenic
1062002908 9:134225850-134225872 GAAGCTAGGGTGTTTGAGACCGG + Intergenic
1203631943 Un_KI270750v1:78891-78913 GACACTAGGGTGATTCAGACAGG + Intergenic
1199460399 X:148077492-148077514 GACAGTAAGGTGATTCTGACAGG - Intergenic