ID: 1171520271

View in Genome Browser
Species Human (GRCh38)
Location 20:25770434-25770456
Sequence CCGGACTCCAGGTGTACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 2, 1: 5, 2: 1, 3: 31, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171520262_1171520271 13 Left 1171520262 20:25770398-25770420 CCATTTTCCTGGTACGTATTAGT 0: 4
1: 1
2: 2
3: 5
4: 127
Right 1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG 0: 2
1: 5
2: 1
3: 31
4: 183
1171520260_1171520271 24 Left 1171520260 20:25770387-25770409 CCAGGTATATACCATTTTCCTGG 0: 7
1: 0
2: 0
3: 31
4: 1096
Right 1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG 0: 2
1: 5
2: 1
3: 31
4: 183
1171520259_1171520271 25 Left 1171520259 20:25770386-25770408 CCCAGGTATATACCATTTTCCTG 0: 7
1: 0
2: 6
3: 348
4: 9012
Right 1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG 0: 2
1: 5
2: 1
3: 31
4: 183
1171520263_1171520271 6 Left 1171520263 20:25770405-25770427 CCTGGTACGTATTAGTAACCAAG No data
Right 1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG 0: 2
1: 5
2: 1
3: 31
4: 183
1171520258_1171520271 26 Left 1171520258 20:25770385-25770407 CCCCAGGTATATACCATTTTCCT 0: 7
1: 0
2: 1
3: 38
4: 424
Right 1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG 0: 2
1: 5
2: 1
3: 31
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171520271 Original CRISPR CCGGACTCCAGGTGTACATC AGG Intronic
907386740 1:54130485-54130507 TGGGATTACAGGTGTACATCTGG - Intergenic
910338131 1:86156247-86156269 CCGGACTTCAGATCTCCATCAGG + Intronic
913225571 1:116695340-116695362 CCAGAATCCAGGTAGACATCTGG + Intronic
914808525 1:151009094-151009116 CTGGCCTCCAGGTGAACCTCGGG + Intronic
915849095 1:159302125-159302147 CCAGATTCCAGGTGTATATGTGG + Intronic
919736375 1:200954699-200954721 GCAGACTCAAGGTGTCCATCTGG + Intergenic
920547279 1:206828957-206828979 CCTGACTACAGGTGTGCATGAGG + Intronic
922298979 1:224278865-224278887 TGGGACTACAGGTGTGCATCTGG + Intronic
1069179306 10:65336732-65336754 CAGGACAACAGGTGTAAATCAGG - Intergenic
1071766051 10:88666713-88666735 TGGGACTACAGGTGTTCATCTGG - Intronic
1072434952 10:95406356-95406378 CCTGAATCCTGGTGTAGATCTGG - Intronic
1074987399 10:118670296-118670318 TCTGACTCCAGGGGGACATCGGG - Intergenic
1077238847 11:1500124-1500146 ACGGAGGCCAGGTGAACATCAGG + Intronic
1085515728 11:77110877-77110899 CCGGCCTCCTGGTGTGCCTCTGG + Intronic
1089937215 11:122376455-122376477 CCCGACTCCATGTGAATATCTGG + Intergenic
1096984074 12:55744913-55744935 CAGGAACCCAGGTGTGCATCTGG + Intronic
1097679652 12:62636856-62636878 CAGGACTACAGGTGCACACCCGG + Intergenic
1101140551 12:101791318-101791340 CAGGAGTTCATGTGTACATCTGG + Intronic
1102021150 12:109683895-109683917 TGGGACTACAGGTGTACATCTGG + Intergenic
1102208555 12:111107295-111107317 AAGGACTCCAGGTGCACACCAGG - Intronic
1107026684 13:35809071-35809093 ACGGCCTCAAGGTGGACATCTGG - Exonic
1107344676 13:39446405-39446427 GCTGTCTCCAGCTGTACATCGGG - Intronic
1113880047 13:113619914-113619936 TCAGACTCCAGGTGGACAGCAGG + Intronic
1114031764 14:18585309-18585331 CCAGACCCCAGGTGAACACCAGG - Intergenic
1114032187 14:18587365-18587387 CTACACTCCAGGTGAACATCAGG + Intergenic
1114032384 14:18588315-18588337 TCAGGCTCCAGGTGGACATCAGG + Intergenic
1114075869 14:19160898-19160920 CTCGGCTCCAGGTGGACATCCGG - Intergenic
1114076279 14:19162888-19162910 CCAGACCCCAGGTGCACTTCTGG - Intergenic
1114076424 14:19163764-19163786 CACGACTCCAGGTGGGCATCAGG - Intergenic
1114076771 14:19165421-19165443 CCAGACCCCAAGTGGACATCAGG - Intergenic
1114076965 14:19166395-19166417 CTACACTCCAGGTGAACATCAGG + Intergenic
1114077165 14:19167341-19167363 TCAGGCTCCAGGTGGACATCAGG + Intergenic
1114084998 14:19232223-19232245 TCAGGCTCCAGGTGGACATCGGG - Intergenic
1114085195 14:19233173-19233195 CTACACTCCAGGTGAACATCAGG - Intergenic
1114085392 14:19234147-19234169 CCAGACCCCAAGTGGACATCAGG + Intergenic
1114085744 14:19235805-19235827 CACGACTCCAGGTGGGCATCAGG + Intergenic
1114085885 14:19236681-19236703 CCAGACCCCAGGTGCACTTCTGG + Intergenic
1118747336 14:68783912-68783934 CCTGACTCCAAATGTACCTCAGG - Intergenic
1202896949 14_GL000194v1_random:15854-15876 CCAGACTCCAAGTGGACATCAGG + Intergenic
1202897442 14_GL000194v1_random:18393-18415 CCAGACCCCAGGTGCACTTCTGG + Intergenic
1202897835 14_GL000194v1_random:20293-20315 CTCGGCTCCAGGTGGACATCCGG + Intergenic
1127269788 15:57390218-57390240 CCAGACTCCAGGCTTCCATCTGG + Intronic
1128358818 15:66946364-66946386 CCGGGCAGCAGGTGTAAATCAGG + Intergenic
1130526183 15:84708651-84708673 TGGGACTACAGGTGTACACCAGG - Intronic
1130843545 15:87723815-87723837 CTGGACTCCAGGGTTCCATCTGG - Intergenic
1136050570 16:27647074-27647096 TGGGACTCCATGTGCACATCTGG + Intronic
1142420503 16:89966745-89966767 CTGGCCTCCAGGTGTGCAGCAGG + Exonic
1142850120 17:2700771-2700793 CCCCATTCCAGGTGTACAGCTGG - Exonic
1144834217 17:18148512-18148534 CCGTACTCCAGGAGTGCACCGGG - Exonic
1145294423 17:21576366-21576388 CCAGTCTTCAGGTGGACATCAGG - Intergenic
1145294471 17:21576566-21576588 CTGAACTCCAGGTGTACATTAGG - Intergenic
1145303149 17:21654507-21654529 CTGGACTTCAGGTATACATCAGG + Intergenic
1145346889 17:22047334-22047356 CTGGACTTCAGGTATACATCAGG - Intergenic
1145347191 17:22048623-22048645 CCAGGCCCCAGGTGTACACCAGG - Intergenic
1145347198 17:22048660-22048682 CTGGACTTGAGGAGTACATCAGG - Intergenic
1145347241 17:22048859-22048881 CTAGACTCCAGGTGGACATCAGG - Intergenic
1145347288 17:22049079-22049101 CTGGACTCCAGGTGTACATCAGG - Intergenic
1145347303 17:22049151-22049173 GCAGGCTCCAGGTGTATATCAGG - Intergenic
1145369363 17:22296614-22296636 CTGAACTCCAGGTGTACATTAGG + Intergenic
1145369409 17:22296814-22296836 CCAGTCTTCAGGTGGACATCAGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157430148 18:47617928-47617950 CTGGAGTGCAGGTCTACATCTGG - Intergenic
1157810245 18:50690013-50690035 CAGGACTCCAGGTTCCCATCTGG + Intronic
1160508033 18:79438081-79438103 CCGGACTCCAGGTCTCCTCCGGG - Intronic
1160774055 19:846669-846691 CAGGACTCCAGGTATCCAGCGGG + Intronic
1160856604 19:1220678-1220700 CCGGCTTCAAGGTGGACATCTGG + Exonic
1160973919 19:1783194-1783216 CGAGACTCCCGGTGTACATGAGG + Exonic
1161313887 19:3608986-3609008 CAGGACACCAGGTGGACCTCGGG + Intergenic
1162704524 19:12545373-12545395 ACTGACTCCAGGTAAACATCTGG - Intronic
1162985623 19:14267523-14267545 GTGTACACCAGGTGTACATCAGG - Intergenic
925461156 2:4063846-4063868 TGGGACTACAGGTGTGCATCTGG + Intergenic
930254994 2:49080358-49080380 TCTGACCCCAGGTGTACATGTGG - Intronic
935946390 2:108290126-108290148 CCTGCCTACAGGTGTACATTGGG + Intronic
938490787 2:131759955-131759977 CCAGTCCCCAGGTGTACATGAGG - Intronic
938491368 2:131762930-131762952 CCAGACCCCAAGTGGACATCAGG - Intronic
938491572 2:131763905-131763927 CTACACTCCAGGTGAACATCAGG + Intronic
938491680 2:131764473-131764495 CCAGACCCCAAGTGAACATCTGG + Intronic
938491711 2:131764620-131764642 CCGGTCCCAAGGTGAACATCAGG + Intronic
938491881 2:131765398-131765420 TCGGGCCCCAGGTGCACATCAGG + Intronic
938495683 2:131796944-131796966 TCGGGCCCCAGGTGCACATCAGG - Intronic
938495858 2:131797722-131797744 CCGGTCCCAAGGTGAACATCAGG - Intronic
938495888 2:131797869-131797891 CCAGACCCCAAGTGAACATCTGG - Intronic
938496194 2:131799396-131799418 CCAGACCCCAAGTGGACATCAGG + Intronic
948883032 2:240870019-240870041 CAGGACCCCAAGTGGACATCAGG + Intronic
1171520247 20:25770325-25770347 CCAGGCCCCAGGTGGACATCAGG + Intronic
1171520255 20:25770362-25770384 ACAGGCTCCAGGTGTATATCAGG + Intronic
1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG + Intronic
1171520321 20:25770654-25770676 CTAGACTCCAGGTGGACATCAGG + Intronic
1171520364 20:25770853-25770875 CTGGACTTGAGGTGTACATCAGG + Intronic
1171520371 20:25770890-25770912 CCAGGCCCCAGGTGTACATCAGG + Intronic
1171520663 20:25772198-25772220 CTGGACTTCAGGTATACATCAGG + Intronic
1171556257 20:26084295-26084317 CTGGACTTCAGGTATACATCAGG - Intergenic
1171556548 20:26085603-26085625 CCAGGCCCCAGGTGTACATCAGG - Intergenic
1171556555 20:26085640-26085662 CTGGACTTGAGGTGTACATCAGG - Intergenic
1171556598 20:26085839-26085861 CTAGACTCCAGGTGGACATCAGG - Intergenic
1171556648 20:26086059-26086081 CCGGACTCCAGGTGTACATCAGG - Intergenic
1171556664 20:26086131-26086153 ACAGGCTCCAGGTGTATATCAGG - Intergenic
1171556672 20:26086168-26086190 CCAGGCCCCAGGTGGACATCAGG - Intergenic
1172448639 20:35006372-35006394 CAGGACTCCAGGTGAACTTCTGG + Intronic
1176365546 21:6030497-6030519 CTGGGTTCCAGGTGTTCATCAGG + Intergenic
1176616636 21:9031850-9031872 CCAGACTCCAAGTGGACATCAGG + Intergenic
1176617127 21:9034382-9034404 CCAGACCCCAGGTGCACTTCTGG + Intergenic
1176617520 21:9036282-9036304 CTCGGCTCCAGGTGGACATCTGG + Intergenic
1176654382 21:9576612-9576634 CCAGGCCCCAGGTGGACATCAGG + Intergenic
1176654390 21:9576649-9576671 ACAGCCTCCAGGTGTATATCAGG + Intergenic
1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG + Intergenic
1176654456 21:9576941-9576963 CTAGACTCCAGGTGGACATCAGG + Intergenic
1176654493 21:9577122-9577144 CTGGACTTGAGGTGTACGTCAGG + Intergenic
1176654500 21:9577159-9577181 CCAGGCCCCAGGTGTACAGCAGG + Intergenic
1176708492 21:10131781-10131803 CCAGACCCCAAGTGGACATCAGG - Intergenic
1176708659 21:10132644-10132666 CCAGGCTCCATATGTACATCAGG + Intergenic
1176708680 21:10132753-10132775 CTATACTCCAGGTGAACATCAGG + Intergenic
1176708894 21:10133833-10133855 CCAGAATCCTGGTGCACATCTGG + Intergenic
1178628933 21:34242715-34242737 CCAAAGTCCAGGTTTACATCAGG - Intergenic
1179757972 21:43508048-43508070 CTGGGTTCCAGGTGTTCATCAGG - Intergenic
1180291569 22:10854062-10854084 CTCGGCTCCAGGTGGACATCCGG - Intergenic
1180292086 22:10856512-10856534 CCAGACCCCAGGTGCACTTCTGG - Intergenic
1180292230 22:10857388-10857410 CACGACTCCAGGTGGGCATCAGG - Intergenic
1180292579 22:10859046-10859068 CCAGACCCCAAGTGGACATCAGG - Intergenic
1180292777 22:10860020-10860042 CTACACTCCAGGTGAACATCAGG + Intergenic
1180292971 22:10860970-10860992 TCAGGCTCCAGGTGGACATCAGG + Intergenic
1180455878 22:15512366-15512388 CCAGACCCCAGGTGAACACCAGG - Intergenic
1180456301 22:15514422-15514444 CTACACTCCAGGTGAACATCAGG + Intergenic
1180456495 22:15515372-15515394 TCAGGCTCCAGGTGGACATCAGG + Intergenic
1180494374 22:15883484-15883506 CTCGGCTCCAGGTGGACATCCGG - Intergenic
1180494890 22:15885934-15885956 CCAGACCCCAGGTGCACTTCTGG - Intergenic
1180495035 22:15886810-15886832 CACGACTCCAGGTGGGCATCAGG - Intergenic
1180495384 22:15888468-15888490 CCAGACCCCAAGTGGACATCAGG - Intergenic
1180495583 22:15889442-15889464 CTACACTCCAGGTGAACATCAGG + Intergenic
1180495777 22:15890392-15890414 TCAGGCTCCAGGTGGACATCAGG + Intergenic
1180940613 22:19657783-19657805 CCAGACCTCAGGTGGACATCAGG - Intergenic
1180940667 22:19658042-19658064 CTGGACTTGAGGCGTACATCAGG - Intergenic
1180940747 22:19658393-19658415 CCAGGCTCCAGGTGGACACCGGG + Intergenic
1180940756 22:19658430-19658452 CCAGACTCCAGGTGGACACCAGG + Intergenic
1181419439 22:22787532-22787554 CCAGGCCCCAGGTGCACATCAGG - Intronic
950331354 3:12158620-12158642 CTGGACTCCTGGTGTACTGCTGG + Intronic
952783448 3:37127459-37127481 CAGGACTCCAAGTATACCTCTGG + Intronic
954429905 3:50465035-50465057 ATGGACTCCAGGAGTACAGCTGG - Intronic
956937686 3:74121798-74121820 TGGGACTACAGGTGTACACCTGG + Intergenic
960274522 3:115713081-115713103 CCAGGCTCCAGATGGACATCTGG + Intronic
961269683 3:125679861-125679883 CCAGGCTCCAGGTGAACATCAGG + Intergenic
969409276 4:7017372-7017394 CCGGACTCCAGCTCTGCATTTGG - Intronic
971681894 4:29710730-29710752 CCTGACTCCAGGTGACAATCAGG - Intergenic
979157837 4:117420266-117420288 GCGGCCTCCAGGTCTACAACTGG - Intergenic
980158254 4:129132370-129132392 CTGGACTCAAGGTGTACATCAGG + Intergenic
992012878 5:72547690-72547712 TAGGACTACAGGTGTACACCAGG + Intergenic
992481779 5:77158715-77158737 CAGGACTCCAGGTTTTCCTCTGG + Intergenic
1001528481 5:172445834-172445856 CCCGCCTGCAGGTGTGCATCTGG + Intronic
1001982518 5:176046732-176046754 CCAGGCTCCAGGTGGACATTAGG + Intergenic
1001982538 5:176046805-176046827 CCAGACCTCAGGTGGACATCAGG + Intergenic
1001982592 5:176047047-176047069 CTGGTCTGCAGGTGCACATCAGG - Intergenic
1001982674 5:176047367-176047389 CTGGATTCAAGCTGTACATCAGG - Intergenic
1001982734 5:176047623-176047645 CCAGGCTCCAGGTGAACGTCAGG - Intergenic
1001982752 5:176047752-176047774 CCAGGCTCCAGGTGGACACCAGG - Intergenic
1001982791 5:176047932-176047954 CAGGACCACAGGTGAACATCAGG - Intergenic
1002234672 5:177796125-177796147 CAGGACCACAGGTGAACATCAGG + Intergenic
1002234711 5:177796305-177796327 CCAGGCTCCAGGTGGACACCAGG + Intergenic
1002234729 5:177796434-177796456 CCAGGCTCCAGGTGAACGTCAGG + Intergenic
1002234789 5:177796690-177796712 CTGGATTCAAGCTGTACATCAGG + Intergenic
1002234870 5:177797010-177797032 CTGGTCTGCAGGTGCACATCAGG + Intergenic
1002234923 5:177797252-177797274 CCAGACCTCAGGTGGACATCAGG - Intergenic
1002234943 5:177797325-177797347 CCAGGCTCCAGGTGGACATTAGG - Intergenic
1003325977 6:5091161-5091183 CCTGATTCCAGGAGTCCATCGGG - Intergenic
1005819412 6:29585263-29585285 CCAGCCTCCACTTGTACATCAGG - Intronic
1006556725 6:34873268-34873290 CAGGACTCCAGGCGGACAACAGG - Exonic
1007097332 6:39221629-39221651 GGGGACTCCAGGTGTGCACCAGG - Intronic
1007491808 6:42228926-42228948 CCAGACTCCAGGTGGACAGGAGG - Intronic
1011595034 6:89008016-89008038 CGGGACTACAGGTGCACAACTGG + Intergenic
1013935436 6:115587812-115587834 TTTGACTCCAGGTCTACATCCGG - Intergenic
1015024807 6:128520216-128520238 CAGGACTCCAGGCGTTCGTCGGG + Intronic
1018145014 6:160877595-160877617 CCAGACTCCAGGAGTGCACCTGG + Intergenic
1022355527 7:29611048-29611070 CTAGACTCCACCTGTACATCCGG - Intergenic
1025280750 7:57625317-57625339 ACAGGCTCCAGGTGTATATCAGG + Intergenic
1025280765 7:57625389-57625411 CTGGACTCCAGGTGTACATCAGG + Intergenic
1025280814 7:57625609-57625631 CTAGACTCCAGGTGGACATCAGG + Intergenic
1025280859 7:57625808-57625830 CTGGACTTGAGGTGTACATCAGG + Intergenic
1025281153 7:57627161-57627183 CTGGACTTCAGGTATACATCAGG + Intergenic
1025303576 7:57838346-57838368 CTGGACTTCAGGTATACATCAGG - Intergenic
1025303871 7:57839699-57839721 CTGGACTTGAGGTGTACATCAGG - Intergenic
1025303916 7:57839898-57839920 CTAGACTCCAGGTGGACATCAGG - Intergenic
1025303965 7:57840118-57840140 CTGGACTCCAGGTGTACATCAGG - Intergenic
1025303980 7:57840190-57840212 ACAGGCTCCAGGTGTATATCAGG - Intergenic
1029579430 7:101425629-101425651 TGGGACTACAGGTGTGCATCAGG + Intronic
1035578987 8:728137-728159 CCTGACTCCATGTGTGCTTCAGG - Intronic
1053644823 9:40114125-40114147 CTCGGCTCCAGGTGGACATCCGG - Intergenic
1053645459 9:40117294-40117316 CCAGACCCCAAGTGGACATCAGG - Intergenic
1053645630 9:40118140-40118162 CCAGGCTCCATGTGTACATCAGG + Intergenic
1053645654 9:40118250-40118272 CTACACTCCAGGTGAACATCAGG + Intergenic
1053645874 9:40119348-40119370 CCAGAATCCGGGTGCACATCTGG + Intergenic
1053759844 9:41344188-41344210 CCAGAATCCGGGTGCACATCTGG - Intergenic
1053760055 9:41345259-41345281 CTACACTCCAGGTGAACATCAGG - Intergenic
1053760079 9:41345369-41345391 CCAGGCTCCATGTGTACATCAGG - Intergenic
1053760255 9:41346233-41346255 CCAGACCCCAAGTGGACATCAGG + Intergenic
1053761161 9:41350726-41350748 CTCGGCTCCAGGTGGACATCCGG + Intergenic
1054325845 9:63712005-63712027 CTCGGCTCCAGGTGGACATCCGG - Intergenic
1054326137 9:63713551-63713573 CATGACTCCAGGTGGGCATCAGG - Intergenic
1054326479 9:63715195-63715217 CCAGACCCCAAGTGGACATCAGG - Intergenic
1054326645 9:63716041-63716063 CCAGGCTCCATGTGTACATCAGG + Intergenic
1054326669 9:63716151-63716173 CTACACTCCAGGTGAACATCAGG + Intergenic
1054326883 9:63717249-63717271 CCAGAATCCGGGTGCACATCTGG + Intergenic
1054538699 9:66256624-66256646 CCAGAATCCGGGTGCACATCTGG - Intergenic
1054538917 9:66257722-66257744 CTACACTCCAGGTGAACATCAGG - Intergenic
1054538943 9:66257832-66257854 CCAGGCTCCATGTGTACATCAGG - Intergenic
1054539114 9:66258678-66258700 CCAGACCCCAAGTGGACATCAGG + Intergenic
1054539753 9:66261844-66261866 CTCGGCTCCAGGTGGACATCCGG + Intergenic
1059332718 9:113546120-113546142 CCGGGCTCCAGGTGCAAAGCAGG - Intronic
1060060875 9:120458438-120458460 CTGGAATCCAGGTATACATGGGG - Exonic
1061586653 9:131573869-131573891 CCAGACTCCAGGAGTACCGCGGG + Intergenic
1202793253 9_KI270719v1_random:100750-100772 CCAGACCCCAAGTGGACATCAGG - Intergenic
1202793420 9_KI270719v1_random:101613-101635 CCAGGCTCCATATGTACATCAGG + Intergenic
1202793441 9_KI270719v1_random:101722-101744 CTATACTCCAGGTGAACATCAGG + Intergenic
1202793655 9_KI270719v1_random:102803-102825 CCAGAATCCTGGTGCACATCTGG + Intergenic
1203632103 Un_KI270750v1:80070-80092 CCAGGCCCCAGGTGGACATCAGG + Intergenic
1203632112 Un_KI270750v1:80107-80129 ACAGGCTCCAGGTGTATATCAGG + Intergenic
1203632127 Un_KI270750v1:80179-80201 CTGGACTCCAGGTGTACATCAGG + Intergenic
1203632175 Un_KI270750v1:80399-80421 CTAGACTCCACGTGGACATCAGG + Intergenic
1203632219 Un_KI270750v1:80617-80639 CCAGGCCCCAGGTGTACAGCAGG + Intergenic
1191242236 X:58198614-58198636 ACAGACTCCTGGTCTACATCAGG + Intergenic
1195688845 X:107607629-107607651 CCAGACTGTGGGTGTACATCTGG + Intergenic
1201149845 Y:11089711-11089733 CCAGGCCCCATGTGTACATCAGG - Intergenic
1201150042 Y:11090701-11090723 CCAGACTCCAAGTGGACATCAGG + Intergenic
1201150519 Y:11093215-11093237 CCAGACCCCAGGTGCACTTCTGG + Intergenic