ID: 1171521174

View in Genome Browser
Species Human (GRCh38)
Location 20:25774972-25774994
Sequence GGCCGCCTGAACCTCCGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 4, 1: 4, 2: 1, 3: 6, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171521164_1171521174 20 Left 1171521164 20:25774929-25774951 CCGGCCCCAGGGAGGCATCACTC 0: 1
1: 5
2: 4
3: 20
4: 293
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112
1171521165_1171521174 16 Left 1171521165 20:25774933-25774955 CCCCAGGGAGGCATCACTCACAG 0: 1
1: 6
2: 1
3: 22
4: 223
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112
1171521171_1171521174 -7 Left 1171521171 20:25774956-25774978 CCGCTTGCGACACCGGGGCCGCC 0: 6
1: 2
2: 0
3: 7
4: 43
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112
1171521166_1171521174 15 Left 1171521166 20:25774934-25774956 CCCAGGGAGGCATCACTCACAGC 0: 1
1: 5
2: 4
3: 18
4: 169
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112
1171521167_1171521174 14 Left 1171521167 20:25774935-25774957 CCAGGGAGGCATCACTCACAGCC 0: 1
1: 7
2: 2
3: 20
4: 216
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112
1171521163_1171521174 25 Left 1171521163 20:25774924-25774946 CCACTCCGGCCCCAGGGAGGCAT 0: 1
1: 5
2: 2
3: 21
4: 249
Right 1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG 0: 4
1: 4
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171521174 Original CRISPR GGCCGCCTGAACCTCCGCCA GGG Exonic
902525856 1:17056801-17056823 GGGCGGCTGTACCTCCGCCCTGG + Intergenic
903368307 1:22818358-22818380 GGCCCCATGAACCACCGCCCTGG + Intronic
905762546 1:40572324-40572346 GGCCGCAGGAACCTCTGCCTAGG + Intergenic
914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG + Intergenic
914437068 1:147669938-147669960 GGCCTCCTGCAGCTCGGCCAGGG + Exonic
916092229 1:161316327-161316349 GGCCGCAAGGACCTCCGCCTAGG - Intronic
920857653 1:209675869-209675891 GGCGGCCTGCAGCTCCGCCACGG - Exonic
922616118 1:226962139-226962161 AGCCTGCTGAGCCTCCGCCAAGG + Intronic
923498148 1:234542553-234542575 GGCTTCCTGCACCTCCTCCAAGG + Intergenic
923765283 1:236887648-236887670 GGCCGCTTTAACCTCTGGCATGG + Intronic
1068793222 10:61049598-61049620 TGCTGCCTGGACCTGCGCCATGG - Intergenic
1070179232 10:73998335-73998357 GGCCGCCTGCACGGCGGCCACGG - Exonic
1070256179 10:74814515-74814537 GGACTCCTGAACCGCCCCCAAGG + Intergenic
1072955755 10:99886459-99886481 GGCCGACTGCAGCTCCTCCAGGG + Exonic
1074495613 10:113977800-113977822 GTCCCCCTGAACCTCTGCCGTGG - Intergenic
1074848158 10:117417162-117417184 GGCAGCCAAAACCTCCGCCGGGG - Intergenic
1076433335 10:130422777-130422799 GGGAGGCTGAGCCTCCGCCAGGG - Intergenic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1079093807 11:17498189-17498211 GGCAGCCTCAGCCTCAGCCAGGG + Exonic
1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG + Intronic
1090380347 11:126322507-126322529 GCCTGCCTGAACCTCCGAAAGGG + Intronic
1091642436 12:2247558-2247580 GGAAGCCTGAAACTCAGCCATGG - Intronic
1092005930 12:5070406-5070428 GGCCAGCTGACCCTCCCCCAGGG - Intergenic
1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG + Intergenic
1093531076 12:20164607-20164629 GGCCTCACGAAGCTCCGCCAAGG - Intergenic
1096872103 12:54599463-54599485 GACCACCTGAACCTCTGCAATGG - Intergenic
1101992590 12:109499545-109499567 GGCCGCCTGAGCCACAGGCAGGG + Intronic
1105242459 13:18620296-18620318 GCACACCTGAACCTCCCCCAGGG + Intergenic
1107145760 13:37059396-37059418 AGCTGCCTCAACCTCCGCCCCGG + Intronic
1122931459 14:104934520-104934542 GGCCCCATGGACCTCCACCAGGG - Exonic
1123488839 15:20764295-20764317 GTACACCTGAACCTCCCCCAGGG - Intergenic
1123545338 15:21333382-21333404 GTACACCTGAACCTCCCCCAGGG - Intergenic
1126101420 15:45120386-45120408 GGGTCCCTGAACCTCCGCCTGGG - Intronic
1129226110 15:74171362-74171384 GGCCGCCAGGATCTCAGCCAAGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131891875 15:96981708-96981730 AGCAGCCTGGACCTCCTCCAGGG + Intergenic
1202953683 15_KI270727v1_random:60653-60675 GTACACCTGAACCTCCCCCAGGG - Intergenic
1132785904 16:1656888-1656910 GGCCGCCAGGACCCCCGCCCCGG + Exonic
1132802277 16:1760289-1760311 GGGCGCCTGCACTTCCGCCCTGG - Intronic
1132869780 16:2110772-2110794 GGGCTCCTGCACCTCCACCAGGG + Exonic
1133807916 16:9139193-9139215 GGCCGCCTGGAGCCCCGACATGG - Intergenic
1134717641 16:16364829-16364851 GGGCTCCTGCACCTCCACCAGGG - Intergenic
1134957111 16:18387330-18387352 GGGCTCCTGCACCTCCACCAGGG + Intergenic
1142169729 16:88615253-88615275 GGCTGCCTCTACCTCCTCCAGGG + Intronic
1142993757 17:3748939-3748961 TGCTGCCTGAAACTCCTCCACGG - Intronic
1143503806 17:7353069-7353091 GGCCGCCTGGACCTGCCCCGTGG + Exonic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1147339086 17:39743204-39743226 GGCAGCCTGCACTTCCACCACGG - Exonic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1154303904 18:13217493-13217515 GGACCCCTGAGCCCCCGCCACGG + Intronic
1154446487 18:14439581-14439603 GCACACCTGAACCTCCCCCAGGG - Intergenic
1160617851 18:80147567-80147589 GGCCCCCTGGACGTCCGCCCTGG + Intergenic
1162271753 19:9621502-9621524 GGCCACCTGAACCACCGGCTAGG - Exonic
1163462694 19:17448459-17448481 GCCCGCAGGAACCCCCGCCATGG - Exonic
1163587926 19:18173900-18173922 GGACGCCTGCACCGCCGCCGTGG - Exonic
1163761170 19:19137611-19137633 GGCGTCCTGCACCTCCGCCTGGG + Intronic
1165406889 19:35636590-35636612 TGCTGCCTGCTCCTCCGCCATGG - Intronic
1167893178 19:52558994-52559016 GGCCGCAGGAACCTCTGCCTAGG + Intronic
925023339 2:588489-588511 GCACACCTGAACCTCCCCCAGGG + Intergenic
929053401 2:37856543-37856565 GTCAGCCTGAACCTCCAACATGG + Intergenic
929208084 2:39321459-39321481 GGCCGCAGGGACCTCCGCCTAGG + Intronic
929578553 2:43067889-43067911 GGCAGGCTGAACCCCCGCCATGG + Intergenic
932496286 2:72147415-72147437 AGCCCCCTGAACCTGCGCCGCGG + Intronic
933868821 2:86548315-86548337 GGCCGCAGGAACCTCTGCCTAGG - Intronic
934563568 2:95325472-95325494 GGCCCCCTGAACCTCCTGCCTGG - Intronic
938270126 2:129962612-129962634 GGCCGCAGGAACCTCTGCCTAGG - Intergenic
948208127 2:236173492-236173514 GGCCGCGTGAACCGCGGCCTGGG + Intergenic
1169196092 20:3682521-3682543 ACCCGACTCAACCTCCGCCAGGG - Intergenic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1171782351 20:29430694-29430716 GGCCGGCTGAACCACAGCCACGG - Intergenic
1175232107 20:57480590-57480612 GGCTGCCTCAGCCTCCTCCAAGG - Intergenic
1175975758 20:62709651-62709673 CGACGCCTGCACCTACGCCACGG + Exonic
1176449495 21:6850262-6850284 GCACACCTGAACCTCCCCCAGGG + Intergenic
1176655026 21:9580084-9580106 GGCCGCCTGAACCTCAGCCAGGG + Intergenic
1176827665 21:13715286-13715308 GCACACCTGAACCTCCCCCAGGG + Intergenic
1178493852 21:33070948-33070970 GGCCGCCTGCGCCGCCGCCGGGG - Exonic
1179884127 21:44306229-44306251 CGCCGCCCCAACCTCTGCCACGG - Intronic
1180082630 21:45493739-45493761 GGCCGGCGGAACCGCCGACATGG - Intronic
1181277301 22:21695018-21695040 GGCCCCCAGACCTTCCGCCAGGG + Exonic
1183306637 22:37086371-37086393 CGACGCCAGAACCTCCACCACGG + Exonic
1185176853 22:49332721-49332743 GGCCTCCTGGACCTACGACAGGG + Intergenic
950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG + Intronic
950444705 3:13029899-13029921 TGCTGCCTGAACCTGCTCCATGG + Intronic
954375914 3:50194057-50194079 GGGGGCCTGAACCTGCGCCCCGG - Intronic
954468981 3:50675322-50675344 GTCCCCCAGAACCCCCGCCACGG - Intronic
956682167 3:71790968-71790990 GGCCACCTGGACCGCTGCCATGG - Intergenic
968605858 4:1534995-1535017 GGCCCCTAGAACCTCCTCCAGGG + Intergenic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
975507663 4:75156962-75156984 GGCAGCCTGAGCCTCCCTCATGG - Intergenic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
987965572 5:24867851-24867873 GGCAGCCTGGACCTCTGCAAAGG + Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1000285360 5:159821699-159821721 GGCCTCCTGACCCTGTGCCAGGG - Intergenic
1004427023 6:15513559-15513581 GGCGGCCAGAAGCTCCGCCGAGG - Intronic
1006360531 6:33584648-33584670 GACCCCCTAAACCTCCCCCAAGG - Intergenic
1017337819 6:153282675-153282697 GGCCACGTGAGCCACCGCCACGG - Intergenic
1019051491 6:169186987-169187009 AGCCGCCTCAACCACCTCCACGG + Intergenic
1021997781 7:26197381-26197403 GGCAGCATCAACCTCAGCCATGG + Exonic
1023913118 7:44569267-44569289 GGCCTCCTGCACCTCCCCCTTGG + Intronic
1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG + Intergenic
1025303077 7:57835600-57835622 GACCGCCTGAACCTCCGCCAGGG - Intergenic
1029547430 7:101217612-101217634 TCCCGCCCGACCCTCCGCCAGGG - Exonic
1029595186 7:101533905-101533927 GGCCACCTGCAACTCTGCCAAGG - Intronic
1029667804 7:102007227-102007249 GGCCTCCTGTACCTAAGCCATGG + Intronic
1034432682 7:151048991-151049013 GGCAGCCTGAGCCTGCGCCGGGG + Exonic
1034939192 7:155219302-155219324 GGTCGCCTGAACCTTCTCCGGGG - Intergenic
1034944502 7:155253304-155253326 GGCTGCCTGGGCCTCAGCCACGG - Intergenic
1040932004 8:52745575-52745597 GTCCGCCTCTACCTCCACCACGG - Intronic
1042182718 8:66107924-66107946 GGCCTCCTGAATCACAGCCAGGG - Intergenic
1044744778 8:95361574-95361596 GGCCTCCTCCACCTCCGTCATGG + Intergenic
1049633698 8:143674079-143674101 GGCCGTCTGACCCTGCGGCAGGG - Intergenic
1049671128 8:143870347-143870369 GGCCGCCTGGGCCTCCAGCAGGG + Exonic
1053826805 9:42033757-42033779 GGCTGCCTGAATCACAGCCACGG + Intronic
1054603754 9:67153666-67153688 GGCTGCCTGAATCACAGCCACGG - Intergenic
1059848365 9:118306987-118307009 TGCTGCCTGAACCACTGCCATGG + Intergenic
1060583340 9:124770957-124770979 GGCTTCCTGAGCCTCCGCCAGGG - Intronic
1061135432 9:128730726-128730748 GGCTGCCTGGACCTCAGCCTAGG + Exonic
1061853732 9:133430071-133430093 TGTCGCCTGCACCTTCGCCAGGG + Exonic
1062068357 9:134540909-134540931 ATCCTCCTGAACCTCCGCCAAGG + Intergenic
1203519692 Un_GL000213v1:34255-34277 GCACACCTGAACCTCCCCCAGGG - Intergenic
1203632751 Un_KI270750v1:83537-83559 GGCCGCCTGAACCTCAGCCAGGG + Intergenic
1190908554 X:54751128-54751150 GCCCGCCTTACCCTCCGCCTTGG - Exonic
1195410795 X:104566465-104566487 TGCCGCCTGCACCTCCGTTAGGG + Exonic
1200081409 X:153578591-153578613 AGCCCCCTGACCCTCCGGCAGGG - Intronic
1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG + Intergenic