ID: 1171521564

View in Genome Browser
Species Human (GRCh38)
Location 20:25779346-25779368
Sequence GATTTTCTATATGCACATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 2, 1: 0, 2: 5, 3: 10, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171521562_1171521564 -6 Left 1171521562 20:25779329-25779351 CCTGGCCACAAGACATAGATTTT 0: 2
1: 0
2: 4
3: 32
4: 371
Right 1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG 0: 2
1: 0
2: 5
3: 10
4: 188
1171521561_1171521564 -1 Left 1171521561 20:25779324-25779346 CCATGCCTGGCCACAAGACATAG 0: 1
1: 1
2: 5
3: 53
4: 516
Right 1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG 0: 2
1: 0
2: 5
3: 10
4: 188
1171521558_1171521564 30 Left 1171521558 20:25779293-25779315 CCCAAGGTACTGCGATTACAGGC 0: 2
1: 127
2: 10280
3: 256996
4: 336409
Right 1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG 0: 2
1: 0
2: 5
3: 10
4: 188
1171521559_1171521564 29 Left 1171521559 20:25779294-25779316 CCAAGGTACTGCGATTACAGGCA 0: 2
1: 70
2: 5216
3: 116776
4: 319434
Right 1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG 0: 2
1: 0
2: 5
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171521564 Original CRISPR GATTTTCTATATGCACATCA AGG Intronic
902855791 1:19203687-19203709 ACTTTGCTATATGCAGATCAAGG + Intronic
903791429 1:25895856-25895878 GATTTTCTAGAAGCAAATGAAGG - Intronic
904734564 1:32621086-32621108 GATTTTCTATATGCACATCAAGG - Exonic
909258580 1:73457040-73457062 TATTTTTTATATGCGGATCATGG - Intergenic
911481477 1:98447445-98447467 GAATTTCTATATGCAGAAGAAGG - Intergenic
911934964 1:103959079-103959101 TATTTTCTAGATGCACAATAAGG + Intergenic
913107882 1:115631438-115631460 GTTTTTATATATGCATATAAAGG - Intergenic
914358264 1:146907545-146907567 GTTTCTATACATGCACATCAAGG - Intergenic
914495161 1:148189462-148189484 GTTTCTATACATGCACATCAAGG + Intergenic
916103559 1:161413287-161413309 GTTTGTGTACATGCACATCAAGG + Intergenic
918621595 1:186611826-186611848 TATTTTCTTTTTGCACACCAAGG - Intergenic
919012615 1:191984310-191984332 GTTTTTCTTTATGTACTTCAGGG + Intergenic
924047831 1:240050586-240050608 GTTTTTGTATGTGAACATCATGG - Intronic
1064708967 10:18103537-18103559 TATTTTCTATATGCTCATTACGG + Intergenic
1065651420 10:27896327-27896349 GATTTTTTAAATTCATATCAAGG + Intronic
1066635322 10:37493981-37494003 GTTTGTATACATGCACATCAAGG + Intergenic
1068265129 10:54638053-54638075 GATTTTCTCTATGTCCTTCATGG + Intronic
1068715593 10:60184343-60184365 GCTTTTCTGTTTTCACATCAGGG + Intronic
1069456162 10:68555551-68555573 TATTTCCTATATGGAGATCAGGG - Intergenic
1070470320 10:76772855-76772877 GTTTTTCAATATGCAAAACAAGG + Intergenic
1073586728 10:104717583-104717605 GGTTTTCTATGTGATCATCAGGG - Intronic
1073643957 10:105280414-105280436 GATTTTCTATCAGCAAATCAAGG - Intergenic
1076471298 10:130720356-130720378 GATTTTCTTTCTACACATTAGGG - Intergenic
1077730515 11:4724292-4724314 GATTTTCTCTATACTCTTCAGGG + Intronic
1077739202 11:4826375-4826397 GAATATCTGTGTGCACATCAGGG - Intronic
1079751540 11:24205391-24205413 GCTTTTAAATATGCACATGATGG - Intergenic
1079879683 11:25909895-25909917 GGTTTTATATATGCATATCCAGG + Intergenic
1082228884 11:49740931-49740953 AAACTTCTATATGCCCATCAGGG + Intergenic
1083394732 11:62382429-62382451 GTTTGTATACATGCACATCAAGG - Intronic
1087288342 11:96291688-96291710 GATATTGTATATGCACACAAAGG + Intronic
1089827747 11:121293820-121293842 GATGTTTTATATGCAGATGAGGG - Intronic
1091799483 12:3315839-3315861 GGTATTCTACAAGCACATCAAGG + Intergenic
1092093944 12:5826478-5826500 AATTTTATATATACATATCAAGG - Intronic
1092253857 12:6915828-6915850 GATCTTCTCTATGGACATGATGG - Exonic
1093366688 12:18309643-18309665 AATTTTCTATATGAACATATAGG - Intronic
1095529455 12:43169207-43169229 CATTTTCAATGTGCACATCAAGG + Intergenic
1095726733 12:45461952-45461974 GCTTTTCTAATTGCACACCAGGG + Intergenic
1098898756 12:76091273-76091295 AATGTTGTATATGCACAACATGG + Intergenic
1100196455 12:92251669-92251691 CATGTGCTATATGCACATTAAGG + Intergenic
1100709279 12:97237402-97237424 GATTTTTTAAATGCATATAATGG + Intergenic
1100946296 12:99787782-99787804 GATTTTCTATCTGCACAGCATGG - Intronic
1102297347 12:111747403-111747425 CACTTTCCAAATGCACATCAGGG + Intronic
1103237840 12:119388652-119388674 AAGTTTCTATATGTACATCTTGG + Intronic
1108152659 13:47552550-47552572 GCTTTTCTATGAGCAAATCATGG - Intergenic
1109966320 13:69701933-69701955 AATTTTCAATATACAAATCATGG - Intronic
1109997433 13:70147259-70147281 GGTTTTATAAATTCACATCATGG - Intergenic
1110524175 13:76516357-76516379 AATGTTCCTTATGCACATCAAGG + Intergenic
1110533532 13:76624943-76624965 CATTTGCTATATCCAAATCATGG - Intergenic
1111157981 13:84353423-84353445 TTTTTTCTAACTGCACATCATGG + Intergenic
1112424210 13:99281982-99282004 GATTTTGTATTTGAACATGAAGG + Intronic
1112873685 13:104007521-104007543 GATTTGCTCTGTGCACACCACGG + Intergenic
1114150605 14:20034437-20034459 GATGTTCTTTATGCACCTCCTGG - Exonic
1114959385 14:27865618-27865640 GTTTTTCAATGTGCACATCTTGG - Intergenic
1115128185 14:30021848-30021870 GATTTTCTATAGGTTCTTCAAGG - Intronic
1116596475 14:46854178-46854200 GATTTTTTTTATGCATTTCATGG - Intronic
1120733151 14:88024972-88024994 GTTTGTGTACATGCACATCAAGG + Intergenic
1121865644 14:97359934-97359956 AGTTTTCTTTATGCTCATCAGGG - Intergenic
1202919314 14_KI270723v1_random:16312-16334 GTTTGTATACATGCACATCAAGG - Intergenic
1202925319 14_KI270724v1_random:18682-18704 GTTTGTATACATGCACATCAAGG + Intergenic
1130435361 15:83892939-83892961 TATTTTCTATATGCCCACCATGG + Intronic
1132199407 15:99939222-99939244 GCATTTCTATATGCAAATAATGG - Intergenic
1135289366 16:21222098-21222120 GTTTCTGTATGTGCACATCAAGG - Intergenic
1135975295 16:27104890-27104912 CATTTTATATATGCACAATAGGG - Intergenic
1146245108 17:31274233-31274255 AATTTACTTTATGCACTTCAAGG - Intronic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
1157417601 18:47518857-47518879 AATTTAGTATATGCACATAAAGG + Intergenic
1157828443 18:50833839-50833861 TATTTTCTGAATGCACATCTTGG + Intergenic
1158134809 18:54196184-54196206 GATTTTCTGCATAGACATCATGG - Intronic
1160406524 18:78650280-78650302 GAATTTCAAAATGCACATTAGGG + Intergenic
1162247494 19:9414309-9414331 GAGTTTGTATACGCACAGCAAGG + Exonic
1162275787 19:9653638-9653660 GAATTTCAAGATGCACAGCAAGG + Exonic
1167867357 19:52339081-52339103 GTTTGTATACATGCACATCAAGG - Intronic
926267590 2:11339358-11339380 AATTTTCTATAATAACATCATGG + Intronic
927062803 2:19440384-19440406 GACTATCTATATGCAAATAAAGG - Intergenic
927924710 2:27003223-27003245 GATTCTCTATATGCACACAGTGG + Intronic
928487468 2:31747214-31747236 GATATTCTATATGGATATAATGG + Intergenic
933033093 2:77356820-77356842 GTTTTCCTATATGCACACAAGGG + Intronic
934994901 2:98948877-98948899 GATGTGCTATTTGCACATCATGG - Intergenic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
937729560 2:125211842-125211864 GTTTTTCTATCTTCACCTCAAGG - Intergenic
937817744 2:126272268-126272290 GATTATCCATACGCTCATCAGGG + Intergenic
940060974 2:149567521-149567543 TCTTTTCTATATTCACTTCATGG - Intergenic
940079680 2:149787102-149787124 GAATTTCTAAATGCATTTCAAGG + Intergenic
942841207 2:180363550-180363572 TATTTTCTAGAAGCACATAATGG - Intergenic
946068346 2:217009485-217009507 CATTTTCCATATCAACATCATGG - Intergenic
946538258 2:220655983-220656005 GCTTGTCCATTTGCACATCAGGG + Intergenic
947598965 2:231433185-231433207 TATTTTCTATATGTACATCAAGG - Intergenic
1170139957 20:13115761-13115783 GATTCACTAAATGCCCATCATGG + Intronic
1170858644 20:20081783-20081805 GATTTTCTATGGGCACATCAGGG - Intronic
1170975210 20:21157553-21157575 CATTTACTATAAGTACATCATGG + Intronic
1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG + Intronic
1171783277 20:29440602-29440624 GTTTGTATACATGCACATCAAGG - Intergenic
1173716627 20:45212838-45212860 AATGTTCTATATGCTCATCTAGG - Intergenic
1176686544 21:9853165-9853187 GATTTTCAATTTGAATATCAAGG - Intergenic
1177240053 21:18444266-18444288 AATGTTGTATATGTACATCACGG + Intronic
1177286005 21:19050793-19050815 GATTTTCTATATGCATAACCAGG + Intergenic
1180592409 22:16952366-16952388 CATGTTCTATAAGCACATTATGG + Intergenic
949387513 3:3519641-3519663 GAATTTCTTTATGCATAACAAGG + Intergenic
949724191 3:7024506-7024528 AATTTTCTATTTGCTCTTCAAGG - Intronic
952067543 3:29589944-29589966 GATTTTCCATATGCACACACTGG - Intronic
952200796 3:31125427-31125449 GGTGATCTATATGCACATTAAGG + Intergenic
952561090 3:34594315-34594337 AATTTTCTAAAAGAACATCAAGG - Intergenic
953077960 3:39588128-39588150 TATGTTCTATATGTAGATCAGGG + Intergenic
954864547 3:53717897-53717919 GATGTTCTATATGCACCTTTTGG + Intronic
957082202 3:75645960-75645982 GTTTGTATACATGCACATCAAGG + Intergenic
957171059 3:76736984-76737006 GAGTTCATATATGCACATCTTGG - Intronic
957859571 3:85928019-85928041 GATTTTCTATATCCTTAGCAAGG - Intronic
958437674 3:94117420-94117442 GATTTTCTGTTTGCAAATGAGGG + Intronic
959144276 3:102525123-102525145 TATTTGCTAAATGCACATCTTGG + Intergenic
959191065 3:103112362-103112384 GATTTTCTCTCTGCACCACATGG - Intergenic
964020386 3:152003315-152003337 GATTCTCTATCTGTAAATCAAGG - Intergenic
966870690 3:184288702-184288724 CATATTTTATATGCATATCAGGG + Intronic
967073177 3:185979821-185979843 GATTTTCTACATGCCCTTGAAGG - Intergenic
967167012 3:186790186-186790208 TATTTTCTACAACCACATCATGG + Exonic
967260913 3:187641078-187641100 GACTTTCTATATTCAAATCCTGG - Intergenic
969882108 4:10183197-10183219 CTTTTACTATATGCAAATCAAGG + Intergenic
970774603 4:19657908-19657930 CATTTTCTCTATACACATGAAGG + Intergenic
971393480 4:26207212-26207234 GTTTTTCTATATCCACTTCTGGG + Intronic
971670648 4:29551752-29551774 GAGTTTCTGAATGCACATCCTGG - Intergenic
971700295 4:29964306-29964328 GGCTTTCTATGTGCAAATCATGG - Intergenic
971766485 4:30838695-30838717 GGTTCTCTCTATGCACATCCTGG + Intronic
971929585 4:33063051-33063073 GATTCCCTATTTGAACATCAAGG + Intergenic
972247589 4:37261697-37261719 GATTTTGTATATTTACATTATGG - Intronic
973172888 4:47167178-47167200 CATTTTCTATATCTACATGATGG + Intronic
974585389 4:63868414-63868436 CATTTTCTAAATGCATACCATGG + Intergenic
975364655 4:73515244-73515266 GGTTTTCTAGATGTTCATCAGGG + Intergenic
976624600 4:87166695-87166717 GATTATTCATATGCACATTATGG + Intronic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
978682482 4:111398284-111398306 GAATTTCTATATGAATGTCATGG - Intergenic
980834724 4:138177175-138177197 GAGATTCAATATGCATATCAAGG + Intronic
982361736 4:154525680-154525702 GACTTTCTATATGCAGAGAAAGG - Intergenic
984613109 4:181863892-181863914 GATTTTATATTTGCTCATCATGG - Intergenic
985919620 5:2959764-2959786 GTTTTTATATTTGCACATCTTGG - Intergenic
986191114 5:5496641-5496663 GATTTTCAACATGCAAATAAAGG - Intergenic
986242162 5:5970874-5970896 GATTTTTAATATGCTCATCCTGG - Intergenic
986757819 5:10854474-10854496 GATTTTATAAATGAAAATCATGG + Intergenic
988886194 5:35560588-35560610 GATGTTCTATTTAGACATCATGG + Intergenic
990201287 5:53378616-53378638 TATATTATATTTGCACATCATGG + Intergenic
990899841 5:60738532-60738554 GATTCTCTATCTGCACCACATGG - Intergenic
992887526 5:81173561-81173583 GATTTTCCATACATACATCATGG - Intronic
995066976 5:107873499-107873521 GATTTTCTCTAGGCACAGCATGG + Intronic
995949357 5:117690922-117690944 AATTCACTATATACACATCATGG - Intergenic
996042029 5:118825356-118825378 GAGTCTCTGTATTCACATCAAGG + Intergenic
999487189 5:152008601-152008623 GAATTTCTATATACACATCAGGG + Intergenic
999823554 5:155252582-155252604 GATTATCTTTATTCACATCTGGG - Intergenic
1000150274 5:158493617-158493639 GAGTTTCTATTTTCAAATCATGG - Intergenic
1005235695 6:23759844-23759866 GTTTTTCTATCTGCATATCCTGG + Intergenic
1007136793 6:39530151-39530173 GCCTTTCTATATACACAGCAGGG + Intronic
1007538017 6:42612478-42612500 TATTTTTTATATGCACACAAAGG + Intronic
1009855525 6:69257827-69257849 GATCTTAGCTATGCACATCAAGG + Intronic
1009929309 6:70157486-70157508 GATTTTCTACAATAACATCAAGG - Intronic
1010535306 6:77020742-77020764 CATTTCCTATATGAACTTCAAGG + Intergenic
1012338679 6:98091446-98091468 GATTTGTTATATGAACATGAGGG - Intergenic
1013766816 6:113584181-113584203 GATGTTCTATGTGAACATAATGG + Intergenic
1014624903 6:123713608-123713630 GATGTTATTTATGTACATCATGG - Intergenic
1014682420 6:124448251-124448273 TATCTTCTATGTGCACATAAGGG + Intronic
1015544478 6:134347526-134347548 GAATTTCAATATCAACATCATGG + Intergenic
1016888775 6:148984807-148984829 GATTTTCTAAATGAAAATCTTGG - Intronic
1018235639 6:161720988-161721010 GATTTTCTAGAGGAATATCATGG + Intronic
1018691397 6:166346912-166346934 GATTTTCTTTATTTGCATCAAGG - Intergenic
1020477571 7:8616327-8616349 TATTTTCTATAGGGTCATCAGGG - Intronic
1020689437 7:11336795-11336817 GATTTTGTACATGCCCATCTGGG + Intergenic
1020818048 7:12930376-12930398 GGATTTCTATATAAACATCAGGG - Intergenic
1020984481 7:15115539-15115561 GATTTGCTACATAGACATCATGG - Intergenic
1023039787 7:36162000-36162022 GAAATTCTATTTGCTCATCATGG + Intronic
1026442422 7:70456084-70456106 GGTTATATGTATGCACATCATGG + Intronic
1027908630 7:84218215-84218237 GATCTGCAATATGCAGATCAAGG - Intronic
1030746523 7:113172782-113172804 GAGTTTTTATAGGCACAGCATGG - Intergenic
1031065048 7:117095754-117095776 GATATTCTATAGACACATCAAGG - Intronic
1031375331 7:121017634-121017656 GACTTTCTATGGGCACAACATGG + Intronic
1031441884 7:121804595-121804617 CCTTTCATATATGCACATCATGG + Intergenic
1031876841 7:127151248-127151270 GATTTTCTCTATGGAGGTCAAGG - Intronic
1032438861 7:131926066-131926088 GAATTTGTACATTCACATCAGGG - Intergenic
1033836656 7:145321583-145321605 GGATTTCTATAGGAACATCAGGG - Intergenic
1037235014 8:16709531-16709553 GAATTTCTTTGTGCACATTATGG + Intergenic
1039666485 8:39537484-39537506 GGTTTACTATATGAAAATCATGG + Intergenic
1041310774 8:56514229-56514251 GATTTTCTATTAGCACACCCTGG + Intergenic
1047352838 8:124092490-124092512 GATTTTCCACATGAACATCCTGG + Intronic
1047717548 8:127609628-127609650 CCCTTTCTATATGCACCTCAGGG + Intergenic
1047925819 8:129681775-129681797 GAATTTATATTTGCACATGATGG - Intergenic
1048133135 8:131719526-131719548 GATGTTCTATATTCTAATCAAGG - Intergenic
1050704359 9:8380175-8380197 GATTTTCTAGGTGCAAAGCAAGG + Intronic
1051397509 9:16640999-16641021 AATTTCCTATATTCACATCCTGG - Intronic
1052334397 9:27304961-27304983 GCTTATGTATATGCACATGAGGG - Intergenic
1056071338 9:82990304-82990326 TATATTCTATCTGCACATTATGG + Intronic
1057476243 9:95405401-95405423 GACTTTGTATATGAACATGATGG + Intergenic
1058263293 9:102864376-102864398 TATTTTCTATATGTAATTCATGG - Intergenic
1059613972 9:115929174-115929196 GATTTTCCATATGGAAAACATGG - Intergenic
1059958931 9:119546356-119546378 TATTTTTTATAGGTACATCAGGG + Intergenic
1061658855 9:132114407-132114429 GGTTTTCTAGATGAACATCGGGG + Intergenic
1185966491 X:4611075-4611097 GATGTTCTTTACGCACATCGTGG - Intergenic
1186794035 X:13026860-13026882 GTTTTTCTATCTGCAAATCAGGG - Intergenic
1189000573 X:36939964-36939986 GATTTTCTATATGTACAAGCAGG - Intergenic
1189437323 X:41004744-41004766 GAGGTTCTATGTGCACATCTAGG - Intergenic
1189520479 X:41762158-41762180 GATTTCCTATATTCAAATCCTGG - Intronic
1190091952 X:47446370-47446392 CATTTCCTACATGCACATTAAGG - Exonic
1191146005 X:57165930-57165952 GATTTTTTATAGGCACAGGATGG - Intergenic
1192563606 X:72144204-72144226 GATTGTCTACATGGAGATCAGGG + Intergenic
1193539145 X:82750020-82750042 TATTTTCTATATCCACTTGAAGG + Intergenic
1194853209 X:98894684-98894706 GATTTTCTAGATGCAATTCGAGG - Intergenic
1195758921 X:108225479-108225501 GATTTTAAATATGCACATCAGGG + Intronic
1196573410 X:117289511-117289533 GATTTTCTCTACTAACATCAAGG + Intergenic
1200956293 Y:8949733-8949755 GCATTTCAATAAGCACATCATGG - Intergenic
1202069536 Y:20976394-20976416 GTTTGTATATGTGCACATCAAGG - Intergenic