ID: 1171530441

View in Genome Browser
Species Human (GRCh38)
Location 20:25849624-25849646
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 3, 1: 1, 2: 2, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171530436_1171530441 23 Left 1171530436 20:25849578-25849600 CCAGGTGTGTGTGCTGAAGTGGA 0: 1
1: 4
2: 4
3: 18
4: 181
Right 1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG 0: 3
1: 1
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900370201 1:2328864-2328886 CTGCCTGGGCCGAGGAACTGGGG + Intronic
902590841 1:17473328-17473350 CTTTCTGGTAACAAGAACTTTGG + Intergenic
902993153 1:20203766-20203788 CTGTCTGGACAGTGCAGCTTCGG - Intergenic
907506494 1:54922862-54922884 GAGTCTGCTCAGAGGATCTTGGG - Intergenic
914195914 1:145448113-145448135 CAGTCTGGTCAGCGGAGCTCAGG - Intergenic
922531461 1:226348478-226348500 TTGTCTGGTTAGAGGAAATGAGG + Intergenic
922591939 1:226783979-226784001 CTTTGTGGTCAGATAAACTTGGG - Intergenic
1063225835 10:4013877-4013899 CTCTCTGTTCACAGGAGCTTGGG + Intergenic
1065210122 10:23394886-23394908 ATGTGTGGTCAGAGGGCCTTTGG + Intergenic
1068959593 10:62853139-62853161 CTGTGTGGTCAGAGGAACTGAGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1071482054 10:86072031-86072053 CTGTCAGGTGAGAGGAAGATGGG + Intronic
1072896046 10:99367830-99367852 GTGTCTGGGCAGGGGAACTATGG - Intronic
1074013563 10:109509059-109509081 CTGTCTGATCAGGGTAACTTAGG - Intergenic
1075650567 10:124126010-124126032 CTGTGTGGGCAGAGCAGCTTCGG - Intergenic
1078962788 11:16298555-16298577 CTATCTGGTCATAGAAACTAAGG + Intronic
1079083670 11:17430655-17430677 CTGGTTGGTCAGAGGGACATTGG - Intronic
1079116700 11:17644781-17644803 CTGTCTTGTCAGAGACACATCGG - Intronic
1080744862 11:35099731-35099753 CTATCTAGTCAGAGGAATTCAGG + Intergenic
1084695364 11:70750407-70750429 CTTTCTGGCCAGAGGAGCTGTGG + Intronic
1085791691 11:79502208-79502230 CTGTCAAGTCAGAGAAACCTGGG + Intergenic
1086038389 11:82444458-82444480 CTGTTTAGTCACAAGAACTTAGG - Intergenic
1086931235 11:92695164-92695186 CTGTCTGGTCAGAAGAAGTAAGG + Intronic
1088928703 11:114327597-114327619 CTCTCTGGTCGGAGGAATTATGG - Intergenic
1089119099 11:116119242-116119264 CTGCCTGGGAAGAGGAATTTCGG - Intergenic
1091890934 12:4053819-4053841 CCTTCTGGTCAGAAAAACTTGGG - Intergenic
1099097543 12:78393743-78393765 CTGCATGGTCAAAGGAACTAGGG + Intergenic
1101041036 12:100755909-100755931 CTGTTTTGTTAGAGGATCTTTGG + Intronic
1103215532 12:119198780-119198802 CTGTCTGGTTAGAGGAACAGAGG - Intronic
1103372561 12:120430526-120430548 CTGTCTGGTCTCAGGATCCTTGG - Intergenic
1105322863 13:19345149-19345171 CTGCCTGCTCACAGGCACTTTGG + Intergenic
1105874526 13:24540719-24540741 CTGCCTGCTCACAGGCACTTTGG - Intergenic
1108545517 13:51489246-51489268 CTGTCTAGTTAGAAGAACATTGG + Intergenic
1114407377 14:22469294-22469316 CCGTCTGGTCCGGGGAACTCTGG + Intergenic
1117750223 14:58914252-58914274 TTTTCTTATCAGAGGAACTTGGG + Intergenic
1120386099 14:83847819-83847841 CTGTTTGTTCAGAGGTACTATGG + Intergenic
1126921787 15:53534826-53534848 CTGTCGTGTAATAGGAACTTGGG - Intronic
1129199259 15:73989069-73989091 CTGCCTTGACAGAGGAACTGGGG - Intronic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1130092405 15:80831806-80831828 CTTTCTTGTCAGAGGGACTCTGG + Intronic
1134328449 16:13228531-13228553 ATGTCTGGAAAGAGGAACATGGG + Intronic
1138588672 16:57987470-57987492 CTGTCTGGCCAGGGGACCTGAGG - Exonic
1140484220 16:75281211-75281233 CTGTCTGGTCCCAGCTACTTAGG - Intergenic
1140996159 16:80261544-80261566 CTGTTCGGTGAGAGGAACTATGG - Intergenic
1141325851 16:83058593-83058615 CTGTGTGGTCAGGGGAGCTCAGG - Intronic
1141517031 16:84552365-84552387 CTGTCTGCACAGAGGTATTTGGG - Intronic
1143644971 17:8224094-8224116 CTGTCTGTCCAGGGGAACCTGGG - Intergenic
1145305181 17:21670182-21670204 CCGCCTGGTCAGAGGAACTTGGG + Intergenic
1146309034 17:31752872-31752894 CTCCCTGCTCAGAGGAAGTTAGG - Intergenic
1148138810 17:45313536-45313558 CTGTCAGGTCAGAGAGACCTGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1154326185 18:13392481-13392503 CCCTCTGCTCAGAGGAACTGGGG - Intronic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1156224064 18:35084927-35084949 CAGTCTGTTAAGGGGAACTTTGG - Intronic
1158033321 18:52993556-52993578 CTGTATTGTCAAAGGAAATTTGG + Intronic
1158548000 18:58412021-58412043 CTACCTGGTCATAGGAAATTAGG + Intergenic
1158576975 18:58646226-58646248 CTGTTTGGTCTGAGGACCTGAGG + Intergenic
1158661537 18:59392892-59392914 ATTTCTGGGAAGAGGAACTTAGG + Intergenic
1159886255 18:73910232-73910254 CTGTCAGGACAGATCAACTTTGG + Intergenic
1162621440 19:11847527-11847549 CTGTCTGGTCAGAGAAAGGGTGG - Intergenic
1163393632 19:17046026-17046048 CTGTCTGTTCAGCGGGGCTTTGG - Intergenic
1167196148 19:48030229-48030251 CTGGCAGGTCACAGGGACTTAGG + Exonic
925596697 2:5562490-5562512 CTGTCTTGTACGATGAACTTCGG - Intergenic
926900324 2:17744113-17744135 CTGTATGGTAAGAGGATGTTTGG + Intronic
927127322 2:20023975-20023997 CTGTCTGGCCAGAGGAATAGTGG - Intergenic
927392485 2:22610956-22610978 TTGTTTGGGCAGGGGAACTTGGG + Intergenic
929580043 2:43076245-43076267 TTGTGTGGTCAGAAGAACTCTGG + Intergenic
932861908 2:75302903-75302925 TTGTGTGGACAGAGGAACTCTGG + Intergenic
938395594 2:130945379-130945401 CTCTCTGACCAGAGGAACTGTGG - Intronic
939201546 2:139042205-139042227 CTGCTTGGTCAGAGGCTCTTTGG - Intergenic
941232974 2:162934232-162934254 CTCTCTGTCCAGAGGAACTTTGG + Intergenic
941388132 2:164878368-164878390 CTGGCTGCTCTGAGGAACATTGG - Intergenic
941780699 2:169441461-169441483 CTCTCTGATCAGAGGAGCTGTGG + Intergenic
942115682 2:172726752-172726774 CTCTCTGGTCAGATGACATTTGG - Intergenic
944204586 2:197144169-197144191 CTGTCTGCTCAGAGGCATTCAGG + Intronic
945375809 2:209078564-209078586 CTGGCTGGTCTGAGGACCTGAGG - Intergenic
946345328 2:219105328-219105350 CTGTCTGGCCAGTGGAAATCTGG - Intronic
946466737 2:219918785-219918807 ATATCAGGTCAAAGGAACTTGGG + Intergenic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948816092 2:240511061-240511083 CTGTCTGGTCAGAGCCTCCTTGG - Intronic
1168980644 20:2000841-2000863 CTTTACAGTCAGAGGAACTTGGG - Intergenic
1168994207 20:2120575-2120597 CTGGCTGGTCAGAGAATCTGAGG + Intronic
1169308273 20:4513591-4513613 CAGAGTGGTCAGAGGAAGTTGGG - Intergenic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1173154314 20:40595038-40595060 GTGTCAGGTCAGAGGCACTCAGG - Intergenic
1173258553 20:41412786-41412808 ATGTCTAGTCTGAGGGACTTAGG + Intronic
1173600032 20:44288138-44288160 CTGTATAGTCAGAAAAACTTTGG - Intergenic
1173863515 20:46299343-46299365 CTGTCTGGTCGAAGGCACTGGGG - Intronic
1179927497 21:44544652-44544674 CTGTCTAGTGAGAGCAACTGAGG + Intronic
1181853224 22:25764907-25764929 CTATCTGGTCTGATGACCTTGGG - Intronic
1184519961 22:44987608-44987630 CTGGGTGGTCAGAGGACCATGGG - Intronic
953668249 3:44941372-44941394 GGCTCTGGTCAGAGAAACTTAGG + Intronic
955550132 3:60075100-60075122 GTTTCTGGTCATAGGAACTTTGG - Intronic
957552260 3:81721425-81721447 ATGTCTGGTCAGAGCACTTTGGG - Intronic
959486043 3:106927866-106927888 CTGGTTGGTCTGAGGACCTTAGG + Intergenic
960550597 3:118972073-118972095 CTTTCTGTTCTTAGGAACTTGGG - Intronic
961207555 3:125097572-125097594 GTGTGTGTTCTGAGGAACTTGGG + Intronic
961804205 3:129477153-129477175 CTTTCTGGTCAGAGTCACTCTGG + Intronic
962841965 3:139241700-139241722 CTGTGTGTTCAGAGCAACATGGG - Intronic
968255848 3:197270865-197270887 ATTTCTGGTAAGAGGAAGTTAGG - Intronic
970764641 4:19532742-19532764 TTGTCTGGACAAAGGAACTCTGG - Intergenic
971640107 4:29120145-29120167 CGGTCTGGTGAGAGGTAATTGGG + Intergenic
975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG + Intronic
985199598 4:187471144-187471166 CTTTCTGCTCACAGGAACCTGGG - Intergenic
985390199 4:189484839-189484861 CTGGCTGGTCTGAGGACCTGAGG + Intergenic
987195932 5:15526141-15526163 GTGTGAGGTCAGAGGGACTTTGG + Intronic
989951463 5:50303140-50303162 CTCTCTGTTAAGAGGAACTGTGG + Intergenic
990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG + Intronic
990576505 5:57128533-57128555 CTGACTGGTCATATGACCTTGGG + Intergenic
992321831 5:75621045-75621067 CTCTCTGACCAGAGGAACTGCGG - Intronic
995099301 5:108278888-108278910 CTGTCTTGTCAAAGGAGGTTGGG - Intronic
995431821 5:112087901-112087923 CTGTCTGGTCATCTAAACTTTGG - Intergenic
995886499 5:116900474-116900496 CTGTCTTGTCAGAGGTCTTTGGG + Intergenic
1000095366 5:157966806-157966828 CTGGCTGCTCAGAGGGATTTGGG - Intergenic
1001015410 5:168136585-168136607 TTGTCTTCTCAAAGGAACTTTGG - Intronic
1001238440 5:170049502-170049524 GTGTTTGGACAGAGGAAATTAGG + Intronic
1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG + Intergenic
1005129672 6:22491491-22491513 CTGTCTGGTCAGAGTTCTTTCGG + Intergenic
1006850701 6:37096200-37096222 CTGGCTGGTTAGATGATCTTGGG - Intergenic
1012358565 6:98347747-98347769 CAGTCTGGTTAGATGAGCTTGGG + Intergenic
1013522591 6:110946664-110946686 CTGTTTGGACAGAGCAACTGGGG + Intergenic
1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG + Intronic
1013645960 6:112141631-112141653 CTGCCTGCTCACAGGAGCTTCGG - Intronic
1015019304 6:128452925-128452947 CTACATAGTCAGAGGAACTTTGG + Intronic
1017394155 6:153977221-153977243 CTGCCTGCTCTGAGGAACTCTGG + Intergenic
1017984162 6:159427968-159427990 CTGTCTGGCCTGTGGCACTTTGG - Intergenic
1018803199 6:167239028-167239050 CTGTCTAATCAGTGTAACTTTGG - Intergenic
1020765508 7:12314762-12314784 CTGTCTGGTTATAGGAATATTGG + Intergenic
1022148244 7:27569804-27569826 CTCTCTGATCAGAGGAACTATGG - Intronic
1023216649 7:37869940-37869962 CTGTCGGATCTGAGGATCTTAGG - Intronic
1023849718 7:44143906-44143928 CTGTCCAGTCAGAGTCACTTAGG - Intergenic
1024995847 7:55272675-55272697 CTGTCTGGAGTGAGGAGCTTGGG - Intergenic
1025283176 7:57642856-57642878 CTGTCTGGTAAGAGGAACTTGGG + Intergenic
1026624122 7:71977308-71977330 CTGTATAGTCCCAGGAACTTGGG + Intronic
1029434737 7:100556656-100556678 CTCTATGATCAGAGGCACTTGGG - Intronic
1030891351 7:115003054-115003076 CTGTTTGGCCAGAGAAATTTTGG - Intronic
1033917024 7:146338692-146338714 CTGACTGGGCAGTGGAACATGGG - Intronic
1036118831 8:5992047-5992069 CTGTGTGGTCACAGGTACTTGGG - Intergenic
1041109661 8:54472572-54472594 CTGTCTCCCCAGAAGAACTTTGG + Intergenic
1041110384 8:54477530-54477552 ATATCAGGTCAGAGGAACTCAGG - Intergenic
1042002667 8:64143802-64143824 CTATCTGTTCATAGGCACTTAGG - Intergenic
1043424122 8:80131893-80131915 CTGTCAAGTCAGAAGAACTAGGG + Intronic
1043594946 8:81874268-81874290 GTGGCTGGTGAGAAGAACTTGGG + Intergenic
1043597677 8:81903455-81903477 CTGTTTGGTCTGAGGACCTGAGG + Intergenic
1045056664 8:98374246-98374268 CTGTCTGGTCTGAACAACTGAGG + Intergenic
1046766156 8:118072522-118072544 CGGTCTGGTCACAGGGGCTTAGG - Intronic
1049705355 8:144039686-144039708 GTGTCTGCTCAGAGGAGCCTGGG - Intronic
1050174741 9:2857944-2857966 CTGTCTGTTCTGAGGCAATTCGG + Intergenic
1052854310 9:33397660-33397682 CTGTGAGGTCAGGGGAATTTAGG + Intronic
1053682319 9:40493821-40493843 CTGTGAGGTCAGGGGAATTTAGG + Intergenic
1053932301 9:43122147-43122169 CTGTGAGGTCAGGGGAATTTAGG + Intergenic
1054281395 9:63131108-63131130 CTGTGAGGTCAGGGGAATTTAGG - Intergenic
1054295419 9:63329321-63329343 CTGTGAGGTCAGGGGAATTTAGG + Intergenic
1054393436 9:64633825-64633847 CTGTGAGGTCAGGGGAATTTAGG + Intergenic
1054428086 9:65139039-65139061 CTGTGAGGTCAGGGGAATTTAGG + Intergenic
1054502293 9:65882505-65882527 CTGTGAGGTCAGGGGAATTTAGG - Intronic
1055776346 9:79770516-79770538 CTTTCTAGTCAGAGCTACTTTGG - Intergenic
1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG + Intergenic
1186770493 X:12813300-12813322 CTGACTGGTCACAGGAGCTGTGG - Intronic
1194414263 X:93591106-93591128 CTATGTGGTAAAAGGAACTTTGG - Intergenic
1195316757 X:103687061-103687083 CCCTCTGGTCAGAGGAACTCTGG - Intronic
1196573128 X:117286629-117286651 CTGACTAGCCATAGGAACTTAGG + Intergenic
1200785548 Y:7257488-7257510 CTGTCAGGTAAGGGGAACTGAGG - Intergenic
1201148614 Y:11081950-11081972 CTGTCTAGGCAGAGGGGCTTTGG + Intergenic