ID: 1171531029

View in Genome Browser
Species Human (GRCh38)
Location 20:25853831-25853853
Sequence ACCTCAGGCGGATCGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171531029_1171531034 -8 Left 1171531029 20:25853831-25853853 CCGCCCGGCGATCCGCCTGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1171531034 20:25853846-25853868 CCTGAGGTTTCTACCTTCTGAGG 0: 3
1: 1
2: 4
3: 45
4: 215
1171531029_1171531035 3 Left 1171531029 20:25853831-25853853 CCGCCCGGCGATCCGCCTGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1171531035 20:25853857-25853879 TACCTTCTGAGGTTTCTTCCTGG 0: 1
1: 4
2: 1
3: 21
4: 202
1171531029_1171531037 6 Left 1171531029 20:25853831-25853853 CCGCCCGGCGATCCGCCTGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1171531037 20:25853860-25853882 CTTCTGAGGTTTCTTCCTGGTGG 0: 4
1: 3
2: 6
3: 32
4: 306
1171531029_1171531039 28 Left 1171531029 20:25853831-25853853 CCGCCCGGCGATCCGCCTGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1171531039 20:25853882-25853904 GTCAGCCCTCCGAGAATCCCAGG 0: 1
1: 2
2: 2
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171531029 Original CRISPR ACCTCAGGCGGATCGCCGGG CGG (reversed) Intronic
901703835 1:11059485-11059507 ACGGCAGGCGGGCCGCCGGGTGG + Intronic
1103393709 12:120591994-120592016 ACCTCAGGCGGCTGGACTGGAGG + Intergenic
1103597012 12:122030238-122030260 ACCTCAGACGCATCGCCCAGAGG + Intronic
1123970972 15:25507589-25507611 ACCTCAGGCTGAACCACGGGTGG + Intergenic
1126102722 15:45129525-45129547 ACCTCACGAGGATCCCCGGAGGG + Exonic
1126440275 15:48680798-48680820 GCCTCAGGCGGATCTTCAGGAGG - Intergenic
1139322798 16:66129077-66129099 ACCTCAGCCTGATCCCCTGGGGG + Intergenic
1167748618 19:51367256-51367278 CCCTGGGGCGGATGGCCGGGAGG + Intronic
1168332316 19:55577914-55577936 AGCTCAGGCGGAGCGGCGGAGGG + Exonic
929537213 2:42791336-42791358 ACCTCAGGGGGAGCGAAGGGAGG + Intronic
1171531029 20:25853831-25853853 ACCTCAGGCGGATCGCCGGGCGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
968687697 4:1972544-1972566 AACCCAGGCGGATGGCCAGGGGG + Intronic
1002433625 5:179218623-179218645 ACCTGAGGTGGATCGGAGGGTGG + Intronic
1021868359 7:24980187-24980209 TCCTCGGGCTAATCGCCGGGCGG - Exonic
1024809156 7:53187294-53187316 ACCTCAGGCTGACCGTAGGGAGG + Intergenic
1036578938 8:10054759-10054781 GCCTCGGGCGGGTCGCGGGGTGG + Intronic
1051626295 9:19102723-19102745 ACCTCAGGCTGACCGTAGGGAGG - Exonic
1200284282 X:154805491-154805513 CCCGCAGGCGGTGCGCCGGGAGG + Exonic