ID: 1171531437

View in Genome Browser
Species Human (GRCh38)
Location 20:25856058-25856080
Sequence GAGCCGACTCCCACCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 3, 1: 15, 2: 27, 3: 35, 4: 91}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171531432_1171531437 -8 Left 1171531432 20:25856043-25856065 CCTCAGGACCTCCTTGAGCCGAC 0: 12
1: 43
2: 31
3: 34
4: 104
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531428_1171531437 7 Left 1171531428 20:25856028-25856050 CCCCAGAAGTCCTGTCCTCAGGA 0: 6
1: 13
2: 26
3: 131
4: 290
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531429_1171531437 6 Left 1171531429 20:25856029-25856051 CCCAGAAGTCCTGTCCTCAGGAC 0: 1
1: 18
2: 22
3: 97
4: 373
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531423_1171531437 25 Left 1171531423 20:25856010-25856032 CCTGTCCCAGGGCGAAACCCCCA 0: 1
1: 21
2: 51
3: 17
4: 112
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531431_1171531437 -3 Left 1171531431 20:25856038-25856060 CCTGTCCTCAGGACCTCCTTGAG 0: 12
1: 81
2: 46
3: 45
4: 282
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531426_1171531437 8 Left 1171531426 20:25856027-25856049 CCCCCAGAAGTCCTGTCCTCAGG 0: 6
1: 12
2: 23
3: 83
4: 310
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531424_1171531437 20 Left 1171531424 20:25856015-25856037 CCCAGGGCGAAACCCCCAGAAGT 0: 1
1: 5
2: 21
3: 24
4: 89
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531425_1171531437 19 Left 1171531425 20:25856016-25856038 CCAGGGCGAAACCCCCAGAAGTC 0: 1
1: 5
2: 22
3: 24
4: 84
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91
1171531430_1171531437 5 Left 1171531430 20:25856030-25856052 CCAGAAGTCCTGTCCTCAGGACC 0: 1
1: 14
2: 23
3: 91
4: 328
Right 1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG 0: 3
1: 15
2: 27
3: 35
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171531437 Original CRISPR GAGCCGACTCCCACCAAGGG AGG Intronic
900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG + Intergenic
903650366 1:24918189-24918211 CAGCTGACTCCCAAGAAGGGAGG + Intronic
903997789 1:27318631-27318653 GCGCTGACTCCCACCAAGAGAGG + Intergenic
904208848 1:28872457-28872479 GAGCCAACTCCCACCAAAGCTGG + Intergenic
907966661 1:59337430-59337452 GTGCCCACTCACATCAAGGGTGG + Intronic
913937097 1:125065269-125065291 GAGCCGACTTCCACCGAGGGAGG + Intergenic
921680081 1:218020825-218020847 GTGCTCCCTCCCACCAAGGGTGG + Intergenic
922668289 1:227491015-227491037 GAGCTGACTCCCACTGAAGGAGG + Intergenic
922671305 1:227510299-227510321 AAGCCGACTCTCACCCAGGGTGG - Intergenic
1063826510 10:9904469-9904491 GAGCTGACTGCTGCCAAGGGCGG - Intergenic
1071869715 10:89780869-89780891 GAGCCCACTGCCTTCAAGGGTGG - Intergenic
1075818367 10:125283985-125284007 GAGCTGACTCAGATCAAGGGTGG + Intergenic
1077369641 11:2175518-2175540 GAGCGGAGCCCCACCAGGGGGGG + Intergenic
1077486426 11:2840821-2840843 AAGCCCACTCCCTCCCAGGGTGG - Intronic
1082822845 11:57556251-57556273 GAGCCGAATCACACCCAGGCAGG - Intronic
1083490036 11:63009274-63009296 GAGCAGACTTCCACCCTGGGAGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084485056 11:69443375-69443397 GGGCCGCCTCCCCCCGAGGGAGG - Intergenic
1084904630 11:72336066-72336088 GTGCTGAATCCCACCTAGGGAGG + Intronic
1092365233 12:7871882-7871904 GAGCACACTCCCACGATGGGTGG - Intronic
1093303215 12:17479079-17479101 TGGCCACCTCCCACCAAGGGAGG + Intergenic
1093677687 12:21962930-21962952 GAGACACCTCCCACCAGGGGCGG + Intergenic
1095038489 12:37419366-37419388 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1095038948 12:37421793-37421815 GAGCCGACTTCCACCAAAGGAGG + Intergenic
1095049473 12:37543580-37543602 GAGCCGACTTCCACCGATGGAGG - Intergenic
1099191949 12:79570015-79570037 GTGCCGACTCTCACCATTGGGGG + Intergenic
1102504077 12:113372821-113372843 AAGCCCCCTCCCACCAAGCGTGG - Intronic
1113577765 13:111406031-111406053 GAGCCGACTACTACAAAGGTAGG + Intergenic
1122117926 14:99536900-99536922 GAGCTGACTCCCAGCCTGGGGGG - Intronic
1123898916 15:24856513-24856535 CAGACCACGCCCACCAAGGGCGG + Intronic
1126130306 15:45334460-45334482 GACACACCTCCCACCAAGGGTGG - Intergenic
1133585633 16:7191952-7191974 GAGCCGTCTCCCTCTAAGGAGGG + Intronic
1136029484 16:27492324-27492346 CAGCCGACACCCACCTAGTGGGG + Exonic
1136999610 16:35217192-35217214 GAGCCCCCACCCACCCAGGGAGG - Intergenic
1137031914 16:35532133-35532155 GAGCCCCCACCCACCCAGGGAGG + Intergenic
1139148120 16:64346385-64346407 GATCCGACATCCACCAAGGGTGG - Intergenic
1139748019 16:69089986-69090008 GAGCCAAATCCCACCAAGGGAGG - Intergenic
1141456497 16:84145565-84145587 GTGCCGACTGCCCCCCAGGGAGG + Intronic
1143350267 17:6282964-6282986 GAGCCAAGTCACATCAAGGGTGG + Intergenic
1145306636 17:21679069-21679091 GAGCCGACTTCTACCCAGGGAGG + Intergenic
1146527779 17:33581586-33581608 GGGCCGACTCCCACCCTGTGGGG - Intronic
1151205375 17:72502553-72502575 GAGCAGCCTCTCTCCAAGGGTGG + Intergenic
1151933395 17:77247167-77247189 GAGCCGACTCGTTCCAGGGGAGG + Intergenic
1152795585 17:82304574-82304596 GAGTCGGCTCCCACCAGGGTGGG - Intergenic
1153389175 18:4534774-4534796 GAGCCTACTGCCATGAAGGGTGG - Intergenic
1156382260 18:36573966-36573988 GAGCCCACTTCCAGCCAGGGTGG - Intronic
1157152084 18:45228420-45228442 GAGCCCACTGCCACCATGGGAGG + Intronic
1157324794 18:46661039-46661061 GACCCGACTTCCACCAATGCTGG + Intergenic
1158302177 18:56064514-56064536 GAGGCGACTGCCACTAAGGAAGG - Intergenic
1161737229 19:5998812-5998834 CGGCCGACCACCACCAAGGGAGG + Intronic
1163884125 19:19950883-19950905 GAGCCAAGTCCCTCCAAGTGGGG + Intergenic
1164684686 19:30158959-30158981 GCCCCTACTCCCACCCAGGGAGG - Intergenic
1164832473 19:31333230-31333252 CCTCCCACTCCCACCAAGGGAGG + Intronic
1164860035 19:31555436-31555458 GAGAGGACTCCCACCAAGCAGGG - Intergenic
1167349080 19:48963767-48963789 CAGCCGGCTTCCAACAAGGGGGG + Intergenic
1167594162 19:50418581-50418603 GAGCCGAATTCCAGCAGGGGCGG - Intronic
927955407 2:27204347-27204369 CAACCGTCTCCCACCCAGGGTGG + Intronic
931343489 2:61425526-61425548 CAGGTGACTCCCACCCAGGGAGG + Intronic
942617505 2:177809353-177809375 GAGCTGACCCCCACAGAGGGAGG + Intronic
943408690 2:187519580-187519602 GAGACAACTCCCAGCAGGGGCGG - Intronic
1171523691 20:25794099-25794121 GAGCCAATTCTCACCAAGGGAGG + Intronic
1171524150 20:25796538-25796560 GAGCTGACTTCCACCGAGGGAGG + Intronic
1171524549 20:25798791-25798813 GAGCCGACTTCCACTGATGGAGG + Intronic
1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG + Intronic
1171531894 20:25858587-25858609 GAGCTGACTTCCACCGAGGGAGG + Intronic
1171532203 20:25860227-25860249 GAGCTGACTTCCACGGAGGGAGG + Intronic
1171532523 20:25861896-25861918 GAGCTGACTTCCACCGAGGGAGG + Intronic
1171532854 20:25863553-25863575 GAGCCGACTTCCACCGAGGGAGG + Intronic
1171533288 20:25866054-25866076 GAGCTGACTTCCACCTTGGGAGG + Intronic
1171544005 20:25987095-25987117 GAGCCAACTTCCACCGATGGAGG - Intergenic
1171552278 20:26057092-26057114 GAGCCGACTTCCACTGATGGAGG - Intergenic
1171552677 20:26059345-26059367 GAGCTGACTTCCACCGAGGGAGG - Intergenic
1171553136 20:26061784-26061806 GAGCCAATTCTCACCAAGGGAGG - Intergenic
1171570839 20:26250528-26250550 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1171573575 20:26276846-26276868 GAGCCGACTCCCACCAAGGGAGG - Intergenic
1171793414 20:29548384-29548406 GAGCCGACTTCCACCTATGGAGG - Intergenic
1171806753 20:29687949-29687971 GAGCAGACTTCCACCGAGGGAGG - Intergenic
1171837294 20:30168580-30168602 GGGCGGACTTCCACCGAGGGAGG + Intergenic
1171847102 20:30283948-30283970 GAGCCGACTTCCACTGAGGGAGG - Intergenic
1171855046 20:30335995-30336017 GAGCCGACTTCCACCGATGGAGG + Intergenic
1176086486 20:63297621-63297643 GAGTCCAGTCCCACCCAGGGAGG - Intronic
1176091336 20:63319860-63319882 AAGCCGAGGCCCAGCAAGGGGGG + Intronic
1176679441 21:9811512-9811534 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1176679724 21:9812919-9812941 GAGCCGATTCCCAGCGAGGGAGG + Intergenic
1176680012 21:9814329-9814351 GAGCTGACTTCCACCAAGGGAGG + Intergenic
1176680296 21:9815738-9815760 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1176680578 21:9817147-9817169 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1176680864 21:9818552-9818574 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1176681148 21:9819959-9819981 GAGTCGACTTCCACCAAGGGAGG + Intergenic
1176681719 21:9822787-9822809 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1176681995 21:9824196-9824218 GAGCCGATTTCCACCGAGGGAGG + Intergenic
1176682280 21:9825597-9825619 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176682559 21:9827006-9827028 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176682837 21:9828425-9828447 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176683117 21:9829822-9829844 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176683396 21:9831232-9831254 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176683676 21:9832641-9832663 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176683955 21:9834044-9834066 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176684233 21:9835453-9835475 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1176684512 21:9836854-9836876 GAGCCGACTTCCACCGAGGGCGG + Intergenic
1176684788 21:9838256-9838278 GAGCCGACTTCCACAAAGGGAGG + Intergenic
1176685091 21:9839679-9839701 GAGCCGACTTCCTCCGAGGGAGG + Intergenic
1180573000 22:16747547-16747569 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1181263936 22:21619156-21619178 GAGCAGTCTCACACCGAGGGTGG + Intronic
1184097832 22:42326096-42326118 GAGCCAACTCCCCCCAGGAGAGG + Intronic
1184585168 22:45442827-45442849 GAGCCGACTCTCCCCATGCGAGG - Intergenic
1185206223 22:49540759-49540781 GAGCCGGCTTCCACCAGGAGTGG - Intronic
1185222531 22:49636241-49636263 GAGGAGACCCCCACCCAGGGTGG + Intronic
950501103 3:13364470-13364492 GAGCAGACATCAACCAAGGGTGG - Intronic
950518931 3:13484909-13484931 GACCCCACCCCCACCAAGGCAGG - Intronic
953921328 3:46954046-46954068 AAGCTGTCTCCCACCAGGGGAGG - Intronic
954100421 3:48368075-48368097 GAGCTCACTTCCTCCAAGGGGGG - Intergenic
968090862 3:195897389-195897411 GGGCCCACTCCCTCCCAGGGGGG + Intronic
976515220 4:85956755-85956777 CAGCCGACACCCAGCCAGGGTGG + Intronic
989753759 5:44926021-44926043 GAGGCTCCTTCCACCAAGGGAGG - Intergenic
1003618851 6:7679746-7679768 GAGCCTACCCTCAGCAAGGGTGG + Intergenic
1007115251 6:39338884-39338906 GAGCCATCTCCCACCCAGGATGG + Intronic
1019310263 7:357055-357077 GAGCAGCCTCCATCCAAGGGGGG - Intergenic
1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG + Intronic
1023890169 7:44386278-44386300 GAGCAGCCTTCGACCAAGGGAGG + Intronic
1025284136 7:57649001-57649023 GAGCCGACTCCCACCAAGGGAGG + Intergenic
1025285012 7:57653858-57653880 AAGCCGACTTCCACCGAGGGAGG + Intergenic
1025295381 7:57772174-57772196 GAGCCGACTTCCACCGATGGAGG - Intergenic
1025301396 7:57821796-57821818 GAGCCGACTTCCGCCGAGGGAGG - Intergenic
1034450024 7:151132280-151132302 GAGCAGCCTCCCACCCAGGCAGG - Intronic
1042204358 8:66313457-66313479 GACTCGCCTCCCACCTAGGGCGG + Intergenic
1044026271 8:87175942-87175964 CAGCTGACCCCCACCAATGGAGG - Intronic
1049167539 8:141136024-141136046 GAGCCTGCCCCCACCCAGGGAGG + Intronic
1049407965 8:142460148-142460170 GAGCCTTCTCACACCAAGGCAGG - Intronic
1053784332 9:41643729-41643751 GAGCCGACTTCCACCGAGGGAGG - Intergenic
1053784901 9:41646618-41646640 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1053792872 9:41699284-41699306 GAGCCGACTTCCGCCGATGGAGG + Intergenic
1054152305 9:61615541-61615563 GAGCCGACTTCCACAGATGGAGG - Intergenic
1054160679 9:61670449-61670471 CAGCCGACTTCCACCGAGGGAGG + Intergenic
1054160969 9:61671858-61671880 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1054172286 9:61853862-61853884 GAGCCGACTTCCACGGAGGGAGG - Intergenic
1054172777 9:61856331-61856353 GAGCCGACTTCCACCGAGGGAGG - Intergenic
1054173066 9:61857702-61857724 GAGCCCACTTCCACCGATGGAGG - Intergenic
1054173627 9:61860563-61860585 GAGCCGACTTCCACTGAGGGAGG + Intergenic
1054181284 9:61911305-61911327 GAGCCGACTTCCGCCGATGGAGG + Intergenic
1054447146 9:65382889-65382911 GAGCCGACTTCCACCGAGGGAGG - Intergenic
1054447623 9:65385334-65385356 GAGCCGACTTCCACGGAGGGAGG - Intergenic
1054447916 9:65386744-65386766 GAGCCGACTTCCTCCGAGGGAGG - Intergenic
1054448481 9:65389628-65389650 GAGCCGACTTCCACTGAGGGAGG + Intergenic
1054472077 9:65546684-65546706 GAGCCGACTTCCACCGATGGAGG - Intergenic
1054656309 9:67669837-67669859 GAGCCGACTTCCGCCGATGGAGG - Intergenic
1054663913 9:67720218-67720240 GAGCCGACTTCCACTGAGGGAGG - Intergenic
1054664476 9:67723079-67723101 GAGCCCACTTCCACCGATGGAGG + Intergenic
1054664763 9:67724470-67724492 GAGCCGACTTCCACCGAGGGAGG + Intergenic
1054665251 9:67726943-67726965 GAGCCGACTTCCACGGAGGGAGG + Intergenic
1059458510 9:114414807-114414829 GAGCCCACTCCATCCCAGGGAGG - Intronic
1061370707 9:130195938-130195960 GAGCCCAGACCCACCGAGGGAGG + Intronic
1062514132 9:136923803-136923825 GAGCTGACACTCAGCAAGGGCGG - Intronic
1203664610 Un_KI270754v1:14048-14070 CAGCCGACTTCCACCAAGGGAGG + Intergenic
1203665180 Un_KI270754v1:16863-16885 CAGCCGACTTCCACCAAGGGAGG + Intergenic
1203665459 Un_KI270754v1:18270-18292 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203665737 Un_KI270754v1:19680-19702 GAGCCGATTTCCAGCGAGGGAGG + Intergenic
1203666028 Un_KI270754v1:21090-21112 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203666317 Un_KI270754v1:22499-22521 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203666605 Un_KI270754v1:23906-23928 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203667175 Un_KI270754v1:26729-26751 GAGCCGACTTCCAGCGAGGGAGG + Intergenic
1203667466 Un_KI270754v1:28138-28160 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203667754 Un_KI270754v1:29545-29567 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203668323 Un_KI270754v1:32368-32390 GAGCCGACTTCCAGCGAGGGAGG + Intergenic
1203668614 Un_KI270754v1:33777-33799 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203668899 Un_KI270754v1:35187-35209 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1203669460 Un_KI270754v1:38003-38025 GAACCGACTTCCACCAAGGGAGG + Intergenic
1203669746 Un_KI270754v1:39410-39432 GAGCCGACTTCCACCAAGGGAGG + Intergenic
1199945169 X:152659467-152659489 GAGAAGACTACCACAAAGGGAGG - Intergenic
1200336308 X:155354325-155354347 GAGCCCACACCAACCAGGGGTGG + Intergenic
1200350162 X:155486902-155486924 GAGCCCACACCAACCAGGGGTGG - Intergenic