ID: 1171533252

View in Genome Browser
Species Human (GRCh38)
Location 20:25865933-25865955
Sequence ATCCAGCCGCTGCGCAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171533252_1171533265 18 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533265 20:25865974-25865996 CGGCGTGGGAGAGGCGACCGCGG 0: 1
1: 4
2: 23
3: 50
4: 147
1171533252_1171533261 3 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533261 20:25865959-25865981 GGCTCCAGTTTGGGGCGGCGTGG 0: 1
1: 10
2: 43
3: 45
4: 142
1171533252_1171533264 9 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533264 20:25865965-25865987 AGTTTGGGGCGGCGTGGGAGAGG 0: 8
1: 46
2: 33
3: 33
4: 304
1171533252_1171533256 -7 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533256 20:25865949-25865971 GCTGGATCCGGGCTCCAGTTTGG 0: 2
1: 24
2: 18
3: 27
4: 96
1171533252_1171533259 -2 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533259 20:25865954-25865976 ATCCGGGCTCCAGTTTGGGGCGG 0: 1
1: 15
2: 12
3: 16
4: 125
1171533252_1171533262 4 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533262 20:25865960-25865982 GCTCCAGTTTGGGGCGGCGTGGG 0: 1
1: 11
2: 46
3: 29
4: 107
1171533252_1171533258 -5 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533258 20:25865951-25865973 TGGATCCGGGCTCCAGTTTGGGG 0: 3
1: 24
2: 16
3: 23
4: 101
1171533252_1171533266 19 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533266 20:25865975-25865997 GGCGTGGGAGAGGCGACCGCGGG 0: 1
1: 1
2: 28
3: 47
4: 203
1171533252_1171533257 -6 Left 1171533252 20:25865933-25865955 CCACCGCTGCGCAGCGGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1171533257 20:25865950-25865972 CTGGATCCGGGCTCCAGTTTGGG 0: 2
1: 22
2: 19
3: 22
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171533252 Original CRISPR ATCCAGCCGCTGCGCAGCGG TGG (reversed) Intronic
900091141 1:921219-921241 CTCCAGCCTCAGCCCAGCGGCGG + Intergenic
902513701 1:16979242-16979264 ATCCAGCCCCAGCTCAGTGGAGG + Intronic
905794304 1:40807032-40807054 ATCCAGCCTATGCCCAGGGGTGG + Intronic
906551219 1:46668051-46668073 ATCCAGCTGCTGCGCAGGTGCGG - Exonic
920968677 1:210723411-210723433 ATCCAGCCACTCCTCAGAGGTGG + Intronic
1064694426 10:17950988-17951010 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
1077910969 11:6571063-6571085 CTCCCGCCGCTGTGCTGCGGTGG + Exonic
1080459545 11:32441140-32441162 ATGCAGCCGCTGGTCAGCAGAGG + Intergenic
1081746036 11:45473178-45473200 AGCAAGCCTCTGCGCAGGGGAGG + Intergenic
1083369963 11:62170677-62170699 ATCCAGCCCCTGGGGAGCGGTGG - Intergenic
1084176586 11:67425528-67425550 ATCCTGCCTCTGTGCAGCAGAGG + Exonic
1084412785 11:69013875-69013897 ATCCTCCCGCTGAGCAGCGCAGG - Intergenic
1089954406 11:122556725-122556747 AACCCGCCGCTGCGCTGTGGGGG + Intergenic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1096180710 12:49549041-49549063 ATGTAGGCGCTGCGCAGCGACGG - Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103407466 12:120686392-120686414 GTCCCGCCCCTACGCAGCGGAGG + Intergenic
1103530674 12:121599310-121599332 ATGCAGCCGCTCCACAGCTGAGG + Intergenic
1109534143 13:63693987-63694009 ATCCTGCCGCTGCACTGTGGGGG - Intergenic
1116084445 14:40217241-40217263 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
1119565709 14:75627505-75627527 ATCCAGCAGCCTCGCAGCCGTGG + Intronic
1125479895 15:40072768-40072790 ATCAAGCCGTAGCGGAGCGGTGG + Intergenic
1127895628 15:63296317-63296339 ATCCTGCCTCTGGGCAGCTGCGG + Intronic
1132516268 16:367561-367583 ATCCACCCACTGCCCACCGGTGG + Exonic
1132753487 16:1470451-1470473 ATACAGCAGCTGCCCCGCGGGGG + Intronic
1133261979 16:4556794-4556816 TTCCAGCAGCTGGGCAGTGGAGG - Exonic
1139088584 16:63617579-63617601 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
1142001744 16:87668210-87668232 ATCCAGCAGCCGCGCAGGGCTGG - Intronic
1142226954 16:88882152-88882174 ACCCAGCCGCTGCGCAGGGACGG + Intronic
1147134889 17:38428837-38428859 CCCCAGCGGCTGGGCAGCGGGGG + Intronic
1149461499 17:56833557-56833579 CGCCCGCCGCTCCGCAGCGGAGG + Intronic
1151591500 17:75047396-75047418 CTCCAGCGGCTGCGCGACGGCGG - Exonic
1152118578 17:78404084-78404106 AGCCAGCCGCTGCGCACCTTTGG - Exonic
1152245803 17:79183978-79184000 CTCCGGCCGCTGCGGAGAGGAGG + Intronic
1152664110 17:81557525-81557547 GTCCAGCCTCTGCCCAGTGGTGG + Exonic
1154132892 18:11751651-11751673 AGGCGGCCGCGGCGCAGCGGAGG + Intronic
1161013526 19:1971325-1971347 GCCCAGCCTCTGCGCAGAGGTGG - Intronic
1161401352 19:4067266-4067288 CCCCAGCCTCTGCGCAGGGGCGG + Intergenic
1162344429 19:10111173-10111195 ATCCAGCCGCTGCTCCGGTGCGG - Exonic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
925744045 2:7029819-7029841 AGCCAGCCACTGTGCAGGGGAGG + Intronic
926980231 2:18560466-18560488 GTCCAGCGGCTGCGCAGAGGCGG - Exonic
927137420 2:20106972-20106994 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
927295427 2:21447585-21447607 ATCCAGCCGCTACACATCTGAGG - Intergenic
927980177 2:27370118-27370140 AACCAGCCGGTGCGCGGCGCGGG + Intronic
928793802 2:34991966-34991988 AGCCCGCCGCTGCGCTGTGGGGG + Intergenic
1170163942 20:13343534-13343556 ATCCAGCCGCCTGGAAGCGGTGG - Intergenic
1171533252 20:25865933-25865955 ATCCAGCCGCTGCGCAGCGGTGG - Intronic
1174353490 20:49983738-49983760 ACCCAGCCCCTGGCCAGCGGTGG + Intronic
1176120648 20:63453105-63453127 ATCCAGCTGCCGCCCCGCGGTGG + Intronic
1176682513 21:9826853-9826875 TCGCGGCCGCTGCGCAGCGGTGG - Intergenic
1176682791 21:9828272-9828294 TCGCGGCCGCTGCGCAGCGGTGG - Intergenic
1176683630 21:9832488-9832510 TCGCGGCCGCTGCGCAGCGGTGG - Intergenic
1176683909 21:9833891-9833913 TCGCGGCCGCTGCGCAGCGGTGG - Intergenic
1176684187 21:9835300-9835322 TCGCGGCCGCTGCGCAGCGGTGG - Intergenic
1177581023 21:23021774-23021796 AGCCCGCCGCTGCGCTGTGGAGG - Intergenic
1183585925 22:38752848-38752870 CTCCAGCCGCTGCACAGTGCAGG - Intronic
1184226027 22:43129261-43129283 CTGCTGCCGCTGCTCAGCGGGGG + Exonic
1185027962 22:48426289-48426311 ATCCCGACCCTGTGCAGCGGGGG - Intergenic
949133666 3:536208-536230 AGCCCGCCGCTGCGCTGAGGGGG - Intergenic
950148305 3:10667285-10667307 ATCCAGCTGGTGAGCAGTGGTGG + Intronic
950961576 3:17113791-17113813 ACCCAGCAGCTGAGCAGCAGGGG + Intergenic
957270945 3:78029854-78029876 ACCCTGCCGCTGCGCTGTGGCGG + Intergenic
957919923 3:86733523-86733545 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
968135446 3:196216774-196216796 GGCCAGTCGCTGGGCAGCGGTGG + Intronic
972784688 4:42315501-42315523 ATCCCGCCGCTGCGCTGTGGGGG - Intergenic
980328397 4:131379281-131379303 AGCCCGCCGCTGCGCTGTGGGGG + Intergenic
982024289 4:151236163-151236185 AGCCTGCCGCTGCGCTGTGGGGG + Intronic
984095420 4:175427841-175427863 AGCCCGCCGCTGCGCTGTGGGGG + Intergenic
992674130 5:79088677-79088699 CTCCAGCTGCTGAGCAGCTGAGG + Exonic
1003824851 6:9942093-9942115 ATCCCGCCACTGCGCTGTGGGGG + Intronic
1006589114 6:35141279-35141301 AACCCGCCGCTCCGCCGCGGTGG - Exonic
1010703112 6:79076944-79076966 ATCCAGCCGCTGCGGTACCGTGG - Intronic
1018531208 6:164765310-164765332 CTGCTGCCGCTCCGCAGCGGTGG - Intergenic
1019422666 7:958328-958350 ATCCAGGCTCAGCGCAGGGGTGG + Intronic
1019717236 7:2544968-2544990 ATCCAGCCGCTGCGCACGGTGGG + Exonic
1021006225 7:15397448-15397470 AGCCCGCCGCTGCGCTGTGGGGG - Intronic
1022089655 7:27099108-27099130 ATCCAGGAGCTGCGCAGCCCTGG + Intergenic
1025608194 7:63054401-63054423 CTCCGGCGGCTGCGCCGCGGCGG - Intergenic
1034970144 7:155413610-155413632 AAGCAGCCGCTGGGCAGCAGGGG + Intergenic
1035948384 8:3991073-3991095 ATGAAGCCGCTGGGCAGCGAAGG - Intronic
1038726644 8:30088060-30088082 AGCCTGCCGCTGCGCTGTGGGGG + Intergenic
1039558735 8:38496048-38496070 ACCCAGCCCCTGTGCAGCAGAGG - Intergenic
1041614791 8:59893726-59893748 CTCCAGCTGCTGAGCAGCTGAGG - Intergenic
1043502806 8:80873842-80873864 GTCCCGGCGCTGCGCGGCGGCGG + Intronic
1044302946 8:90606548-90606570 AGCCCGCCGCTGCGCTGTGGGGG - Intergenic
1047760375 8:127949888-127949910 ATCCAGCCGCTGGGCAGGGCCGG - Intergenic
1048295821 8:133212623-133212645 ATCCTTCCGCTGGTCAGCGGTGG - Intronic
1049612117 8:143560631-143560653 CTGCAGCAGCTGCGCAGCCGCGG + Exonic
1049827211 8:144676813-144676835 AGCCAGCTGCTGCGCTGTGGGGG - Intergenic
1056235609 9:84590892-84590914 AGCCAGCCACTGGGCAGAGGTGG - Intergenic
1057179525 9:93022261-93022283 ACGCAGCCACTGTGCAGCGGGGG - Intronic
1188248583 X:27863837-27863859 AACCAGCCGCGGAGCAGGGGCGG - Intergenic