ID: 1171534408

View in Genome Browser
Species Human (GRCh38)
Location 20:25873487-25873509
Sequence ATGTGTTCAGGGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171534399_1171534408 15 Left 1171534399 20:25873449-25873471 CCCACATCTCAACTTGAATTGTA 0: 18
1: 789
2: 9208
3: 10419
4: 8549
Right 1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG No data
1171534400_1171534408 14 Left 1171534400 20:25873450-25873472 CCACATCTCAACTTGAATTGTAT 0: 15
1: 591
2: 971
3: 9250
4: 10680
Right 1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG No data
1171534398_1171534408 19 Left 1171534398 20:25873445-25873467 CCTACCCACATCTCAACTTGAAT 0: 19
1: 803
2: 9954
3: 11012
4: 9580
Right 1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG No data
1171534397_1171534408 20 Left 1171534397 20:25873444-25873466 CCCTACCCACATCTCAACTTGAA 0: 13
1: 59
2: 1508
3: 10926
4: 12036
Right 1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171534408 Original CRISPR ATGTGTTCAGGGAGGGAACC AGG Intergenic
No off target data available for this crispr