ID: 1171535712

View in Genome Browser
Species Human (GRCh38)
Location 20:25887016-25887038
Sequence CAGTAAAAGTATTTTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171535712_1171535715 8 Left 1171535712 20:25887016-25887038 CCAGACTCAAAATACTTTTACTG No data
Right 1171535715 20:25887047-25887069 CCATGTCTTATTTACTGAGGAGG No data
1171535712_1171535713 5 Left 1171535712 20:25887016-25887038 CCAGACTCAAAATACTTTTACTG No data
Right 1171535713 20:25887044-25887066 ATTCCATGTCTTATTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171535712 Original CRISPR CAGTAAAAGTATTTTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr