ID: 1171536159

View in Genome Browser
Species Human (GRCh38)
Location 20:25892549-25892571
Sequence TTCAACTCGTTCTTCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171536159_1171536161 1 Left 1171536159 20:25892549-25892571 CCAGATTTGAAGAACGAGTTGAA No data
Right 1171536161 20:25892573-25892595 TTTACTGGAGACAGAAATAGAGG No data
1171536159_1171536163 6 Left 1171536159 20:25892549-25892571 CCAGATTTGAAGAACGAGTTGAA No data
Right 1171536163 20:25892578-25892600 TGGAGACAGAAATAGAGGAAGGG No data
1171536159_1171536162 5 Left 1171536159 20:25892549-25892571 CCAGATTTGAAGAACGAGTTGAA No data
Right 1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171536159 Original CRISPR TTCAACTCGTTCTTCAAATC TGG (reversed) Intergenic
No off target data available for this crispr