ID: 1171536159 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:25892549-25892571 |
Sequence | TTCAACTCGTTCTTCAAATC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1171536159_1171536161 | 1 | Left | 1171536159 | 20:25892549-25892571 | CCAGATTTGAAGAACGAGTTGAA | No data | ||
Right | 1171536161 | 20:25892573-25892595 | TTTACTGGAGACAGAAATAGAGG | No data | ||||
1171536159_1171536163 | 6 | Left | 1171536159 | 20:25892549-25892571 | CCAGATTTGAAGAACGAGTTGAA | No data | ||
Right | 1171536163 | 20:25892578-25892600 | TGGAGACAGAAATAGAGGAAGGG | No data | ||||
1171536159_1171536162 | 5 | Left | 1171536159 | 20:25892549-25892571 | CCAGATTTGAAGAACGAGTTGAA | No data | ||
Right | 1171536162 | 20:25892577-25892599 | CTGGAGACAGAAATAGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1171536159 | Original CRISPR | TTCAACTCGTTCTTCAAATC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |