ID: 1171536161

View in Genome Browser
Species Human (GRCh38)
Location 20:25892573-25892595
Sequence TTTACTGGAGACAGAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171536159_1171536161 1 Left 1171536159 20:25892549-25892571 CCAGATTTGAAGAACGAGTTGAA No data
Right 1171536161 20:25892573-25892595 TTTACTGGAGACAGAAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171536161 Original CRISPR TTTACTGGAGACAGAAATAG AGG Intergenic
No off target data available for this crispr