ID: 1171542616

View in Genome Browser
Species Human (GRCh38)
Location 20:25976153-25976175
Sequence AGATGTCAGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171542616_1171542621 -7 Left 1171542616 20:25976153-25976175 CCTGCCATTTTCTGCTGACATCT No data
Right 1171542621 20:25976169-25976191 GACATCTGCCTCTGGGGTCTTGG No data
1171542616_1171542622 -6 Left 1171542616 20:25976153-25976175 CCTGCCATTTTCTGCTGACATCT No data
Right 1171542622 20:25976170-25976192 ACATCTGCCTCTGGGGTCTTGGG No data
1171542616_1171542624 12 Left 1171542616 20:25976153-25976175 CCTGCCATTTTCTGCTGACATCT No data
Right 1171542624 20:25976188-25976210 TTGGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171542616 Original CRISPR AGATGTCAGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr