ID: 1171542621

View in Genome Browser
Species Human (GRCh38)
Location 20:25976169-25976191
Sequence GACATCTGCCTCTGGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171542612_1171542621 25 Left 1171542612 20:25976121-25976143 CCAGGATGAAGGGAGGCAGTGAG 0: 20
1: 55
2: 48
3: 164
4: 620
Right 1171542621 20:25976169-25976191 GACATCTGCCTCTGGGGTCTTGG No data
1171542616_1171542621 -7 Left 1171542616 20:25976153-25976175 CCTGCCATTTTCTGCTGACATCT No data
Right 1171542621 20:25976169-25976191 GACATCTGCCTCTGGGGTCTTGG No data
1171542615_1171542621 -6 Left 1171542615 20:25976152-25976174 CCCTGCCATTTTCTGCTGACATC No data
Right 1171542621 20:25976169-25976191 GACATCTGCCTCTGGGGTCTTGG No data
1171542611_1171542621 26 Left 1171542611 20:25976120-25976142 CCCAGGATGAAGGGAGGCAGTGA 0: 28
1: 52
2: 47
3: 116
4: 464
Right 1171542621 20:25976169-25976191 GACATCTGCCTCTGGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171542621 Original CRISPR GACATCTGCCTCTGGGGTCT TGG Intergenic
No off target data available for this crispr