ID: 1171542624

View in Genome Browser
Species Human (GRCh38)
Location 20:25976188-25976210
Sequence TTGGGTATGATTTCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171542617_1171542624 8 Left 1171542617 20:25976157-25976179 CCATTTTCTGCTGACATCTGCCT No data
Right 1171542624 20:25976188-25976210 TTGGGTATGATTTCATCACCTGG No data
1171542616_1171542624 12 Left 1171542616 20:25976153-25976175 CCTGCCATTTTCTGCTGACATCT No data
Right 1171542624 20:25976188-25976210 TTGGGTATGATTTCATCACCTGG No data
1171542615_1171542624 13 Left 1171542615 20:25976152-25976174 CCCTGCCATTTTCTGCTGACATC No data
Right 1171542624 20:25976188-25976210 TTGGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171542624 Original CRISPR TTGGGTATGATTTCATCACC TGG Intergenic
No off target data available for this crispr