ID: 1171544211

View in Genome Browser
Species Human (GRCh38)
Location 20:25988325-25988347
Sequence CTCTGGACAAGTCACTGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171544207_1171544211 -1 Left 1171544207 20:25988303-25988325 CCTGTCACGGGAACGCTGGCCTC No data
Right 1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG No data
1171544202_1171544211 24 Left 1171544202 20:25988278-25988300 CCGGGAATGGGAGATGGCAACAA 0: 11
1: 43
2: 7
3: 19
4: 188
Right 1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG No data
1171544206_1171544211 0 Left 1171544206 20:25988302-25988324 CCCTGTCACGGGAACGCTGGCCT No data
Right 1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171544211 Original CRISPR CTCTGGACAAGTCACTGGTT AGG Intergenic
No off target data available for this crispr