ID: 1171549428

View in Genome Browser
Species Human (GRCh38)
Location 20:26030218-26030240
Sequence ATTAAGACAATGATCCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 5, 1: 5, 2: 0, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171549428 Original CRISPR ATTAAGACAATGATCCTTAC AGG (reversed) Intergenic
902136580 1:14311454-14311476 ATTAAGACAGTGGACCTTACGGG + Intergenic
909055254 1:70813423-70813445 AGTAAGACAATGAATGTTACAGG - Intergenic
909231396 1:73094952-73094974 TATAGGACTATGATCCTTACAGG + Intergenic
909286605 1:73827548-73827570 ATTAAATCAATGATCCTTCTTGG - Intergenic
911553217 1:99309981-99310003 ATTAATATAATGAGCCTTAATGG - Intergenic
915628901 1:157137169-157137191 ATTAACACAAAGCTCCTTGCTGG - Intronic
917941126 1:179922673-179922695 ATAGAGACAGTGATCATTACAGG + Intronic
920127268 1:203703300-203703322 ATTAAAACAACCATCCTTCCTGG - Intronic
920951038 1:210571999-210572021 ATTAAGAGAAAAATGCTTACCGG + Intronic
1063775446 10:9258526-9258548 ATTGACACAATTATCCTCACAGG + Intergenic
1064806993 10:19146512-19146534 ATTAAAACAATGCTCCTTTCAGG - Intronic
1068546217 10:58348421-58348443 AACAAGACAGTGATTCTTACTGG - Intronic
1071534352 10:86415502-86415524 ATTAAGAGAATGGACCTCACGGG - Intergenic
1073007634 10:100336937-100336959 ACTATGACAATGATTCTTAATGG + Intergenic
1073988771 10:109240216-109240238 ATGAAGAAAATGGTCCTAACAGG - Intergenic
1078911242 11:15734446-15734468 ATGAAAAAAATGATCCTAACTGG - Intergenic
1079381315 11:19940285-19940307 ATGTAGACAATGATGATTACAGG + Intronic
1079871537 11:25804133-25804155 ATTGAGACAATGATTGTTATTGG - Intergenic
1083063281 11:59897228-59897250 ATTAACACACAAATCCTTACTGG - Intergenic
1087664077 11:101022564-101022586 TTTAAGAAAATCATCTTTACTGG - Intergenic
1087728829 11:101755604-101755626 ATTCAGACAATGATCAATAATGG + Intronic
1088345073 11:108814727-108814749 ATTAAGTTAATGATCATTAGGGG + Intronic
1089567320 11:119378595-119378617 ATTAAGGCAAGAATCCTGACTGG + Intronic
1092203968 12:6604517-6604539 CTTAAGAAAATGATTCTTTCTGG - Intronic
1092785885 12:12026127-12026149 ACAAATGCAATGATCCTTACAGG + Intergenic
1093376550 12:18434877-18434899 ATTAAAATGATGATTCTTACTGG - Intronic
1095054859 12:37586625-37586647 ATTAAGACAATGATCCTTACAGG - Intergenic
1095352274 12:41227690-41227712 ATTAAGACATTGATGCTACCAGG + Intronic
1095943926 12:47743444-47743466 ATGATGACAATGATCTTGACTGG + Intronic
1096732013 12:53621444-53621466 ATTAACAAAATGATAATTACAGG + Intronic
1096916147 12:55035540-55035562 AAGAAGGCAATGATTCTTACAGG - Intergenic
1097767151 12:63539148-63539170 ATGAAGACTATTATCTTTACTGG - Intergenic
1097964027 12:65560085-65560107 GATAACACAATGATTCTTACTGG - Intergenic
1102406992 12:112682038-112682060 GTTAAGACACTGAAACTTACAGG - Intronic
1106286402 13:28321647-28321669 ATTAAGATAATGACACTGACAGG - Intronic
1106667017 13:31862316-31862338 TTTAGGACAATGACACTTACTGG + Intergenic
1107093431 13:36509186-36509208 ATTAATACAATCATGTTTACTGG + Intergenic
1108715206 13:53071967-53071989 AATAAGAGAAGGATCCTTTCAGG - Intergenic
1108727269 13:53196262-53196284 ATTAATATAATGATCTTTACGGG + Intergenic
1109581981 13:64351970-64351992 ATTGAAACAATGATCCATAAAGG - Intergenic
1114548016 14:23516453-23516475 GTTAGAACAATGATCCTCACTGG + Intergenic
1114896662 14:26999260-26999282 ATTAGCACAATGATCGTGACAGG - Intergenic
1115150935 14:30284778-30284800 ATTAAGAAAATGACACTTAGAGG + Intergenic
1118071703 14:62252648-62252670 AATAAGAAAATGATCCAGACTGG - Intergenic
1118574652 14:67230140-67230162 ATTAATAAATTGATTCTTACAGG + Intergenic
1120993969 14:90401219-90401241 ATAAAGACATTGATTCTAACGGG + Intronic
1121839575 14:97121773-97121795 ACTCAGACAATCATGCTTACTGG - Intergenic
1123573361 15:21638974-21638996 TTTAGGACAATGATCCTCAGGGG - Exonic
1123609983 15:22081592-22081614 TTTAGGACAATGATCCTCAGGGG - Intergenic
1124367679 15:29085026-29085048 ATCTAGACAATGATCATTAATGG - Intronic
1125045142 15:35236793-35236815 ATTAAAGCAATTATTCTTACTGG - Intronic
1126655139 15:50968964-50968986 ATTAACATAATGATCTTTATGGG + Intronic
1127207771 15:56738136-56738158 ATCAACACACTGATCCTCACTGG + Intronic
1129697942 15:77751264-77751286 AGTAAGGGAATGATCCTTGCAGG + Intronic
1202982229 15_KI270727v1_random:373387-373409 TTTAGGACAATGATCCTCAGGGG - Intergenic
1134334151 16:13279862-13279884 ATTAATACAAAGAGCATTACTGG - Intergenic
1134911879 16:18034847-18034869 GTTAAGCCTATGATCCTTAAAGG + Intergenic
1136106265 16:28032193-28032215 ATTAAGAAAAAGAGCCTTTCTGG - Intronic
1138906782 16:61345971-61345993 TTTAAGATAATGATACTTAAGGG - Intergenic
1139022826 16:62772973-62772995 ATTAAGACAAGGAGCCTTGAAGG - Intergenic
1145375536 17:22344206-22344228 ATTAAGACAATGATCCTTACAGG - Intergenic
1154065780 18:11105835-11105857 ATTAAGCCACTGATCTTTCCTGG - Intronic
1157948639 18:52009519-52009541 AATAAGATAATGATTCTTAAGGG - Intergenic
1165611578 19:37158280-37158302 ATTTAGACAATAATCATTAATGG + Intronic
925485053 2:4319391-4319413 ATTAAGACTCTGATTCTTAGTGG - Intergenic
926474433 2:13304776-13304798 ATTTAAACAATCATCCTAACAGG + Intergenic
926662906 2:15488064-15488086 ATTATGACATTGATCCATTCAGG + Intronic
927627394 2:24736311-24736333 ATGAAGATCATGATCCTTGCTGG - Intronic
928552595 2:32387706-32387728 ATTTAGACAATTACCATTACTGG - Intronic
929835710 2:45396086-45396108 ATCATGACAATGATCCTAAAAGG + Intronic
930503530 2:52254491-52254513 ATTAAAACAAGGATCTCTACAGG + Intergenic
930566243 2:53024040-53024062 ATTAGGACAGAGATCCTGACTGG - Intergenic
935525101 2:104156028-104156050 ATTAAGACAATGCTCCCCAGTGG + Intergenic
937123374 2:119456433-119456455 ATTAAAAAAATGTTCCTTTCAGG + Intronic
939585924 2:144005551-144005573 AGTAACACATTCATCCTTACGGG - Intronic
939767189 2:146265604-146265626 ATTAAGACAATTACCGTTAAAGG - Intergenic
940927030 2:159375523-159375545 ATTAACAAAATGATCCTTTGAGG + Intronic
941943591 2:171070470-171070492 ATTAAGACAATGCAACTTATGGG - Intronic
943829626 2:192443713-192443735 ATTAATAAACTGATTCTTACTGG + Intergenic
944445866 2:199787539-199787561 ATTAAGACATTGAGACTTTCTGG + Intronic
946244321 2:218377750-218377772 ATGAAGACCATGATCCATAAAGG - Intergenic
947293408 2:228602855-228602877 ATTAAGACCATCATCCTTATAGG + Intergenic
949069434 2:242015099-242015121 ATTAAAAGAAAGATCCTCACTGG - Intergenic
1170230163 20:14037717-14037739 ATTAAGACATTGTTCCTTGCTGG + Intronic
1171527398 20:25825666-25825688 ATTAAGACAATGATCCTTACAGG + Intronic
1171549428 20:26030218-26030240 ATTAAGACAATGATCCTTACAGG - Intergenic
1175007077 20:55695677-55695699 ATTAAAAGAAGGATCTTTACAGG + Intergenic
1175586581 20:60145886-60145908 ATTAAGACAATGATCCAGATAGG + Intergenic
950796900 3:15517454-15517476 ACAAAGACAATGATATTTACCGG - Intronic
951035066 3:17923750-17923772 ATTTAGAAAATGATGCTTTCTGG + Intronic
955782109 3:62495933-62495955 ATAAAAACAATAATCCTTAAAGG - Intronic
956863631 3:73348639-73348661 ATCAAGGCACTGAACCTTACCGG + Intergenic
960709764 3:120516242-120516264 ATGAAGACTATGTTCCTTGCTGG + Intergenic
965876669 3:173331500-173331522 ATTAAGACAAAGATCCACCCAGG - Intergenic
966060646 3:175750096-175750118 ATTAAGACACTGAGCCTCAGAGG + Intronic
970730240 4:19094589-19094611 AGCAAAACAATGATCATTACAGG - Intergenic
973096697 4:46210930-46210952 AACAAGACAATGAATCTTACTGG + Intergenic
974387165 4:61216607-61216629 ATTAATGAAATGATCTTTACTGG + Intronic
975120890 4:70727185-70727207 ATTAATATAATGATGCTTAAAGG - Intronic
975537444 4:75466734-75466756 TCTAAGACAATGATCATCACTGG + Intergenic
975941066 4:79646694-79646716 ATTAAAACAGTAATCCTTGCTGG + Intergenic
977800123 4:101218084-101218106 ATTAAGACCCTGTTCCTTGCTGG - Intronic
981612976 4:146615819-146615841 ATAGAGACAATGATTCTTGCTGG + Intergenic
981985505 4:150849827-150849849 TTGAAGAAAATTATCCTTACTGG + Intronic
982595559 4:157379671-157379693 ATTAAGAAAATCATCCTGGCCGG + Intergenic
984061690 4:174996462-174996484 ATTAAAACAATCATACATACAGG + Intergenic
986811991 5:11369837-11369859 AGTAAGAGAATGAGCCTCACTGG + Intronic
988699036 5:33654609-33654631 ACTAAGACTTTGATCCCTACAGG - Intronic
988753388 5:34216080-34216102 AGTAAAACAATTATCCATACAGG + Intergenic
993598080 5:89884697-89884719 ATTAAAACATTAATCCCTACAGG + Intergenic
994893604 5:105671340-105671362 AATAAGTCAATTATCCCTACGGG - Intergenic
997689626 5:135818001-135818023 CTTAAGACAGTGATCCATGCAGG + Intergenic
1002813686 6:659263-659285 AATAAGACAAAGATGCTTTCTGG - Intronic
1004046016 6:12024067-12024089 ATTAATACTATGCTCATTACAGG + Intronic
1005478110 6:26228380-26228402 AATAAGAAAATGAACTTTACAGG + Intergenic
1005551556 6:26922901-26922923 AGTAAAACAATTATCCATACAGG + Intergenic
1009578548 6:65499914-65499936 ATTATGACAATGATCCTGTGAGG + Intronic
1016187582 6:141216702-141216724 ATGAAGACAGAGATCCTTACTGG - Intergenic
1016912276 6:149210892-149210914 TTTAAGAGAATGATAATTACAGG + Intergenic
1018256939 6:161930074-161930096 AATAAAACAATGAGCCATACTGG + Intronic
1019909536 7:4091247-4091269 ACAAAGGCAATGATCCTTACTGG + Intronic
1021365230 7:19770471-19770493 ATAAACACAATGATCCCAACTGG + Intronic
1022610464 7:31866927-31866949 ATGAAGACATTGCTCCATACAGG + Intronic
1022693250 7:32679241-32679263 ATTAAGACAATGAATTTCACAGG + Intergenic
1023969969 7:44983683-44983705 TTGAAGACAATGAACCTTTCTGG + Intergenic
1024433654 7:49322276-49322298 ATTAAGTCATTAATGCTTACAGG + Intergenic
1025298251 7:57794211-57794233 ATTAAGACAATGATCCTTACAGG - Intergenic
1027966926 7:85023915-85023937 ATTAAGAAACTGATACTTTCTGG + Intronic
1028457040 7:91049815-91049837 AAAAAGCAAATGATCCTTACAGG + Intronic
1030646516 7:112067356-112067378 ATTAAGACAGTGCTTCTTTCTGG + Intronic
1030804850 7:113903498-113903520 ATGAACACCATGATACTTACAGG - Intronic
1031192111 7:118566018-118566040 ATTTAGACTATGATTCTTTCTGG - Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1034758476 7:153647098-153647120 ATAAAGACAATGCTGCATACTGG - Intergenic
1036685565 8:10907537-10907559 ATGAAGACACTGAGGCTTACAGG + Intronic
1039117566 8:34109331-34109353 ATTAAGAAAATGAGCCTCAGAGG - Intergenic
1039257096 8:35731476-35731498 ATTAAGAGAATGAGACTTAGAGG + Intronic
1040552407 8:48448213-48448235 ATTAAGAAAATGATTTTTATTGG + Intergenic
1043057366 8:75456143-75456165 ATGTAGAAAATGAGCCTTACTGG - Intronic
1043653679 8:82633849-82633871 ATAAAAATAATGATGCTTACTGG + Intergenic
1048067335 8:130983732-130983754 ACTAAGAAGATGATCCTGACAGG + Intronic
1048113802 8:131497434-131497456 ATTAAAACAGTTAACCTTACAGG + Intergenic
1050622129 9:7465269-7465291 AAGAAGACATTGATCATTACAGG - Intergenic
1053795343 9:41721814-41721836 ATTAATACAATGATCCTTACAGG + Intergenic
1054149829 9:61593040-61593062 ATTAACACAATGATCCTTACAGG - Intergenic
1054183755 9:61933880-61933902 ATTAATACAATGATCCTTACAGG + Intergenic
1054469596 9:65524142-65524164 ATTAACACAATGATCCTTACAGG - Intergenic
1054654752 9:67654608-67654630 ATTAATACAATGATCCTTACAGG - Intergenic
1055459400 9:76503656-76503678 ATTAAAACACTGACCATTACGGG + Exonic
1057811945 9:98264656-98264678 ATTATTACAATGATCCTGCCAGG - Intergenic
1061673927 9:132204723-132204745 ATGGGGACAATGATCCTCACAGG - Intronic
1186120221 X:6352510-6352532 ATTAAGACAATTCTTCTGACTGG + Intergenic
1189827662 X:44936274-44936296 ATTAAGATAAGGATCCTGAAAGG - Intronic
1201283754 Y:12362092-12362114 ATTAAGACATTCATCTTTATGGG - Intergenic
1201524592 Y:14917983-14918005 ATTAAGACAAGAATCTTTTCTGG + Intergenic
1202000700 Y:20152477-20152499 AGCAAGACAATGATCCTGCCAGG - Intergenic
1202003446 Y:20189262-20189284 AGCAAGACAATGATCCTGCCAGG - Intergenic