ID: 1171553431

View in Genome Browser
Species Human (GRCh38)
Location 20:26063480-26063502
Sequence TCCCACTGGGTGATCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 2, 1: 2, 2: 5, 3: 77, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171553431_1171553436 -2 Left 1171553431 20:26063480-26063502 CCATTCCTGATCACCCAGTGGGA 0: 2
1: 2
2: 5
3: 77
4: 212
Right 1171553436 20:26063501-26063523 GATCCATAGTCAGGTCGAAGAGG 0: 3
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171553431 Original CRISPR TCCCACTGGGTGATCAGGAA TGG (reversed) Intergenic
900318428 1:2070706-2070728 CCCCACTGTGGGGTCAGGAAGGG - Intronic
900518057 1:3092556-3092578 TCCCACTCGCTGACCAGAAATGG - Intronic
900719611 1:4166784-4166806 TTCCACTGGGGGATCTGGAATGG - Intergenic
901449393 1:9326733-9326755 TCCCACTGGCGGAGCAGAAATGG + Intronic
901581310 1:10246182-10246204 CCACTCTGGGTGGTCAGGAAGGG - Intronic
902065459 1:13681940-13681962 TCCACCTGGGAGGTCAGGAAAGG + Intergenic
902239913 1:15081610-15081632 CCACACTAGGTGACCAGGAAAGG + Intronic
911439178 1:97904056-97904078 TACCCCAGGGTAATCAGGAAGGG + Intronic
911931769 1:103913392-103913414 GTCCACTGGTTTATCAGGAAAGG + Intergenic
913207570 1:116555108-116555130 TACCACTGAGTGGTCAGAAAAGG + Intronic
914356012 1:146885262-146885284 TTACACAGTGTGATCAGGAAGGG - Intergenic
914650576 1:149695033-149695055 TCCAATTTAGTGATCAGGAAAGG - Intergenic
915804579 1:158831004-158831026 TGCCACTCTGTGAACAGGAAAGG + Intergenic
916687064 1:167157037-167157059 TCCCTCAGGGTGAGCAGGACAGG - Intergenic
918241741 1:182626254-182626276 TCCCAGAGGGTGAGCAGGGAAGG - Intergenic
918391009 1:184062095-184062117 TCCCACTAGATAATCAGAAATGG - Intronic
919604609 1:199666573-199666595 TCCCAGGGGGTGATAAAGAATGG - Intergenic
921013083 1:211161923-211161945 CCCCACCTGGTGATGAGGAATGG + Intergenic
1063113537 10:3056887-3056909 TCCCACTGGATCATCAGGTGGGG - Intergenic
1068811196 10:61257475-61257497 TCCCACTCAGTGAGGAGGAATGG + Intergenic
1069629590 10:69889524-69889546 TCCCACAGGGACAACAGGAATGG + Intronic
1069828697 10:71269848-71269870 TTTCACTGGGTGGTCAGGGAAGG + Intronic
1070726528 10:78795319-78795341 TCCCTCTGGGAGAGGAGGAAGGG + Intergenic
1070747914 10:78945975-78945997 TCCCACAGGGAGCTCAGGAGGGG - Intergenic
1075276992 10:121103108-121103130 AACCACTGGGTGATCTTGAATGG + Intergenic
1077022259 11:422665-422687 TCCCACTGGGTGAAAACTAAGGG - Intronic
1077351066 11:2093392-2093414 ACCGGCTGGGTGATGAGGAAAGG + Intergenic
1084914913 11:72421416-72421438 TATCACTGGGGGATCAGGGAAGG + Intronic
1085317230 11:75552977-75552999 TCACACCAGGTGCTCAGGAATGG - Intergenic
1087025903 11:93649636-93649658 TCCTACAGGGTGATTAGGAAAGG + Intergenic
1087126180 11:94627772-94627794 TCCTACTGGAAGATAAGGAAAGG + Intergenic
1090711829 11:129393279-129393301 TCCCAAAGGGTGATCAGGACCGG - Intronic
1091291011 11:134439918-134439940 TCCCAGGTGGTGATCAGGAAAGG + Intergenic
1092405377 12:8218313-8218335 TCCCCATGGGGGCTCAGGAAAGG + Intergenic
1092512393 12:9170765-9170787 TCCCACTCGATGAGGAGGAATGG - Intronic
1093065523 12:14654210-14654232 TCCCACTGCTAGAACAGGAAGGG - Intronic
1093778565 12:23106727-23106749 TCAGACTGGGTTGTCAGGAAAGG + Intergenic
1094502346 12:31032693-31032715 TCGCACAGGGTGATCACTAAAGG + Intergenic
1095050158 12:37547509-37547531 TCCGAACGGGTGATCAGGAATGG - Intergenic
1095904900 12:47367816-47367838 TTAGACTGGGTGGTCAGGAAAGG + Intergenic
1096418933 12:51439431-51439453 TCGGAGTGGGTAATCAGGAAAGG + Intronic
1098728819 12:74006053-74006075 TCCCACTTGGTCATGATGAATGG - Intergenic
1099052419 12:77796721-77796743 TGCCACTGACTGATCAGCAAAGG - Intergenic
1102423805 12:112824751-112824773 TTCCACTGGGTGGTCAGCCAGGG + Intronic
1103932951 12:124460240-124460262 TCACAGTGGATGCTCAGGAATGG + Intronic
1103994709 12:124821588-124821610 TCCAACTGGGTGATCAGGGATGG + Intronic
1104996944 12:132664184-132664206 ACACACTGGGTGAAAAGGAAAGG - Intronic
1110747518 13:79071905-79071927 TCACAGTGGGTATTCAGGAAGGG + Intergenic
1113799964 13:113081157-113081179 TAGCACTGGGAGAGCAGGAATGG - Intronic
1117201421 14:53393794-53393816 TCTCAACAGGTGATCAGGAATGG - Intergenic
1118114134 14:62755750-62755772 TCCCACTTGGTCATGATGAATGG - Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121947223 14:98135156-98135178 TGACACTGGGTGATAATGAAAGG - Intergenic
1124139455 15:27064450-27064472 GCCCACTGGCTCCTCAGGAAAGG + Intronic
1124700680 15:31909434-31909456 TCCCAGTGAGTGATCAACAAGGG - Intergenic
1125083863 15:35706877-35706899 TCCCATAGACTGATCAGGAAAGG - Intergenic
1126208908 15:46077576-46077598 TTACACTGGGTGATCAGAAAAGG - Intergenic
1126804635 15:52334883-52334905 TCTGTCTGGGTAATCAGGAAAGG + Intronic
1127617717 15:60703521-60703543 TCCCACTGTCTGATCAGCAGTGG + Intronic
1128311684 15:66634852-66634874 CCCCACAGGGTCATCAGGTAGGG + Intronic
1129748599 15:78043261-78043283 TCCCACTGGTTTTTCAGGATGGG - Intronic
1131336429 15:91553614-91553636 AACCAGTGGGTGATTAGGAAAGG + Intergenic
1131379321 15:91950444-91950466 TCCCGGTGGGTTATTAGGAAGGG + Intronic
1131559425 15:93426609-93426631 TTTCCCTGGGTGCTCAGGAATGG + Intergenic
1132213006 15:100039496-100039518 ACCCACTGGTTGTTTAGGAAGGG + Intronic
1134319933 16:13153583-13153605 TCCCACAGGGTCTTCAGAAAAGG + Intronic
1136989402 16:35142901-35142923 TCCCACCAGGTGAACAGGGATGG - Intergenic
1138452964 16:57104751-57104773 TCAGCCTGGGTGATCAGGGAAGG + Intronic
1138593482 16:58016414-58016436 TACAACTGGGTGTTCAGGAGAGG + Intronic
1139558044 16:67725035-67725057 TACCATTGGGGAATCAGGAAAGG - Exonic
1139936139 16:70572529-70572551 TCCCACTGGGTATTGAGGAAGGG + Exonic
1139978004 16:70830200-70830222 TTACACAGTGTGATCAGGAAGGG + Intronic
1141910015 16:87052595-87052617 ATCCACTGGGTGTTCAGGAAAGG - Intergenic
1143892986 17:10116510-10116532 AGCCACTGGGTGCTCAGGAAAGG + Intronic
1145004872 17:19332146-19332168 TCCCACTGTGTGACGGGGAAGGG + Intronic
1145305892 17:21674901-21674923 TCCCACGGGGTGATCAGGAATGG + Intergenic
1145370771 17:22304589-22304611 TCTGATAGGGTGATCAGGAATGG - Intergenic
1148326265 17:46785143-46785165 TCCCACTGTGTGGTCAGAGAGGG - Intronic
1148714988 17:49709486-49709508 TCCCACTGTATAATCAGGAAAGG - Intergenic
1151904336 17:77037900-77037922 TCCCACAGGGTGAAGAGGAAGGG - Intergenic
1155169046 18:23253608-23253630 TCCCAGAGGGTGATCTGGACTGG - Intronic
1156450506 18:37263843-37263865 GCCCTCTGGGTGACCAGGAGAGG - Intronic
1157329874 18:46696032-46696054 TCAGACTGAGTGATCAGGGAAGG + Intronic
1157555990 18:48613180-48613202 TGTCACTGGGTGGGCAGGAAAGG + Intronic
1158906846 18:62021487-62021509 TCCCACTGGGTGACATGAAAAGG + Intergenic
1160535102 18:79587387-79587409 GCCCACTGGGTGGGCAGGAGTGG - Intergenic
1161579602 19:5073542-5073564 TCACACTGGGTGAGAAGGGAGGG - Intronic
1162234583 19:9297951-9297973 TCCCACTGGGAGATCAGATGGGG + Exonic
1162403341 19:10459282-10459304 ACCCACTGGGTGAGCAATAATGG + Intronic
1162974369 19:14200043-14200065 TTCAACAGGATGATCAGGAAAGG + Intronic
1164938608 19:32233774-32233796 TGCAACTGGGAGATCAGGTAAGG - Intergenic
1165509381 19:36257339-36257361 TCCCACCGGGTGATCGAGAATGG - Intergenic
1165510920 19:36266317-36266339 TCCCACCGGGTGATCGGGAATGG - Intergenic
1165511426 19:36268737-36268759 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165511974 19:36271260-36271282 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165512526 19:36273761-36273783 TCCCAGCGTGTGATCGGGAATGG - Intergenic
1165513073 19:36276302-36276324 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165513629 19:36278857-36278879 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165514179 19:36281391-36281413 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165514731 19:36283928-36283950 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165515283 19:36286461-36286483 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165515833 19:36288997-36289019 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165516384 19:36291534-36291556 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165516936 19:36294060-36294082 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165517489 19:36296583-36296605 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165518041 19:36299118-36299140 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165518592 19:36301653-36301675 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165519141 19:36304185-36304207 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165519691 19:36306700-36306722 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165520240 19:36309228-36309250 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165595671 19:37009772-37009794 TCCCACCAGGTGACCAGGGATGG - Intronic
1165601157 19:37056696-37056718 TCCCACCAGGTGAGCAGGGATGG - Intronic
1165601584 19:37059056-37059078 TCCCACTGGGTGAGCAGGGATGG - Intronic
1165623828 19:37269354-37269376 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165624373 19:37271894-37271916 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165624918 19:37274421-37274443 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165625454 19:37276959-37276981 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165625990 19:37279484-37279506 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165626534 19:37282011-37282033 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165627073 19:37284536-37284558 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165627616 19:37287060-37287082 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165628151 19:37289584-37289606 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165628693 19:37292110-37292132 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165629233 19:37294635-37294657 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165629776 19:37297161-37297183 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165630318 19:37299688-37299710 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165630854 19:37302226-37302248 TCCAACCGGGTGATCGGGAATGG + Intergenic
1165631356 19:37304693-37304715 TCCGACCCGGTGATCAGTAATGG + Intergenic
1167077805 19:47259860-47259882 TTCCACAGGGTGCTCAGGGAAGG + Intronic
1167699753 19:51035464-51035486 TCCAAATAGGTGATCAGGCAGGG + Intergenic
925259502 2:2517494-2517516 TCCCTCTGGGTGACCAGGAGGGG - Intergenic
925646696 2:6044003-6044025 TCTCACTGAGTGAGGAGGAATGG - Intergenic
934647361 2:96066767-96066789 TCTCCCTGGGTACTCAGGAAAGG + Intergenic
935486612 2:103663896-103663918 TCCCACTTGGTGCTCTGGAAGGG + Intergenic
935835443 2:107047243-107047265 TCCCACTTGGTCATGATGAATGG + Intergenic
937033009 2:118756567-118756589 TCCCACTGAGTCCACAGGAATGG + Intergenic
938762167 2:134435885-134435907 TCCCATTGGGTGCTCAGAGAAGG - Intronic
939976233 2:148720158-148720180 TCCCACTCAGTGAAGAGGAATGG + Intronic
939999798 2:148955743-148955765 TCCCACTGTGGGAGCAGGAGAGG - Intronic
940078911 2:149777987-149778009 TCCTACAGGGTGATTAGGAAAGG + Intergenic
941344381 2:164348912-164348934 TTCCACCAGGTGATGAGGAATGG + Intergenic
942441322 2:176039784-176039806 TCCTACTGGGGGATTAGCAAAGG - Intergenic
946397917 2:219452578-219452600 TCCCACTGGGTGACCAGACCTGG + Intronic
948079226 2:235191758-235191780 TCACACAGGGTGGTCAGGAAGGG - Intergenic
1169548720 20:6679226-6679248 TCCTACTGAGAAATCAGGAAAGG + Intergenic
1171523395 20:25792403-25792425 TCCCACTGGGTGATCAGGAATGG + Intronic
1171531138 20:25854360-25854382 TCCCACGGGGTGATCAAGAATGG + Intronic
1171544673 20:25991023-25991045 TCCGAACCGGTGATCAGGAATGG - Intergenic
1171553431 20:26063480-26063502 TCCCACTGGGTGATCAGGAATGG - Intergenic
1173535078 20:43803225-43803247 TCTGACTGGGTGATCAGGGAAGG - Intergenic
1173724702 20:45289242-45289264 GCACAGTGGATGATCAGGAAGGG - Intergenic
1174288094 20:49486134-49486156 TTACACAGGGTGGTCAGGAAGGG + Intergenic
1174291633 20:49513105-49513127 TCTCTCTGGGGGCTCAGGAAGGG + Exonic
1175012574 20:55754525-55754547 TCCCAATGGTTGATCAGGTGGGG - Intergenic
1176226804 20:64004933-64004955 TCCCTCTGGGGGCACAGGAATGG + Intronic
1176705894 21:10119843-10119865 TCCCACCCGGTGATCGGGAATGG + Intergenic
1180073280 21:45449348-45449370 CTCCACTGGGTGATCACGAGTGG - Intronic
1180179165 21:46110234-46110256 TCACACTGGCTGCTCAGGGAGGG - Intronic
1183234922 22:36609986-36610008 TCCCAGAGCGTGATCAGGCAGGG + Intronic
1184044515 22:41964377-41964399 TCACACTGGCTGAGAAGGAAGGG + Intergenic
949494862 3:4621895-4621917 TTCTACAGGGTCATCAGGAAAGG - Intronic
949879974 3:8653894-8653916 TCCCACTGGGTGGGGTGGAAGGG - Intronic
950108454 3:10403395-10403417 GCCCACGGGGTGAACAGAAAAGG + Intronic
950461055 3:13122446-13122468 TCCCTCTGGCTGTTCAGGGAGGG + Intergenic
950699119 3:14727857-14727879 TCCCAGTGGGGGAGCAGGATGGG - Intronic
953315120 3:41920124-41920146 TCCCACTGGCTTAACAGCAAAGG + Intronic
954314912 3:49795795-49795817 ACCCACAGGTTGAGCAGGAATGG - Intronic
959574687 3:107921864-107921886 GCCCATTGGCTGATCGGGAAAGG + Intergenic
960841440 3:121963241-121963263 TCCCACTTAGTGAGGAGGAATGG - Intergenic
962511921 3:136110151-136110173 TCTCACTGGCTGCTTAGGAAGGG - Intronic
964112623 3:153103345-153103367 TCCCAGAGGGTGTTGAGGAAGGG + Intergenic
964140441 3:153392601-153392623 TCCCACTTGGTCATGAAGAATGG + Intergenic
964739726 3:159952741-159952763 TCAGATTGGGTGATCAGGGATGG + Intergenic
966236699 3:177709235-177709257 TCACACTGGATAATCAGGGAAGG - Intergenic
966334798 3:178856139-178856161 GCCCATTGGGTGATGGGGAATGG - Intergenic
967038185 3:185663846-185663868 TCCCACTTGGTCATGATGAATGG + Intronic
969760740 4:9179658-9179680 TCCCCATGGGGGCTCAGGAAAGG - Intergenic
970458170 4:16246268-16246290 TACCACTTGGTGATGAGGCAGGG - Intergenic
971377482 4:26066614-26066636 TCCCGTTGAGTGATTAGGAAAGG - Intergenic
972990219 4:44814888-44814910 TCCCACTCAGTGAGGAGGAATGG + Intergenic
975618413 4:76270755-76270777 TCCCACAGGGTGATGAGACAGGG - Intronic
976030830 4:80751557-80751579 TCCCACTCAGTGAGGAGGAATGG + Intronic
976050126 4:81001773-81001795 TTTCACTGGGTCATCAGGGAAGG - Intergenic
976156067 4:82146066-82146088 TCACATTGGGTGATCAAGAAGGG + Intergenic
977670826 4:99693135-99693157 TGCCCTGGGGTGATCAGGAAAGG - Intergenic
979183691 4:117760299-117760321 TCACATTGGTTGATCTGGAAGGG + Intergenic
979817289 4:125125517-125125539 TTCAATTGGGTGGTCAGGAAAGG + Intergenic
980354490 4:131724698-131724720 TCCCACCCGCTGATCGGGAATGG - Intergenic
980355022 4:131727204-131727226 TCCCACCTGCTGATCGGGAATGG - Intergenic
980355568 4:131729691-131729713 TCCCACCGGCTGATCGGGAATGG - Intergenic
980356113 4:131732182-131732204 TCCCACCGGCTGATCGGGAATGG - Intergenic
980357184 4:131737158-131737180 TCCCACCGGCTGATCGGGAATGG - Intergenic
980357726 4:131739653-131739675 TCCCACCGGCTGATCGGGAATGG - Intergenic
980358796 4:131744633-131744655 TCCCACCGGCTGATCGGGAATGG - Intergenic
980359336 4:131747106-131747128 TCCCACCGGCTGATCGGGAATGG - Intergenic
980360419 4:131752069-131752091 TCCCACCGGCTGATCGGGAATGG - Intergenic
980360960 4:131754541-131754563 TCCCACCGGCTGATCGGGAATGG - Intergenic
980361502 4:131757024-131757046 TCCCACCGGCTGATCGGGAATGG - Intergenic
980362043 4:131759496-131759518 TCCCACCGGCTGATCGGGAATGG - Intergenic
980362585 4:131761979-131762001 TCCCACCGGCTGATCGGGAATGG - Intergenic
980363128 4:131764458-131764480 TCCCACCGGCTGATCGGGAATGG - Intergenic
980378154 4:131976530-131976552 TCCCACCGGGCGATCGGCAATGG + Intergenic
981598011 4:146449169-146449191 TCCCACTGGGTGACAGGGATAGG + Intronic
985095740 4:186411389-186411411 TCTAAATGGGTAATCAGGAAAGG + Intergenic
986004421 5:3656239-3656261 CCCCACTGGGTGAACAGGCTGGG - Intergenic
986573457 5:9189023-9189045 TGCCACTGAGTGGTCAGGTAAGG - Intronic
990825205 5:59892132-59892154 TGTCCCTGGGTTATCAGGAAAGG + Intronic
992146829 5:73859060-73859082 AGGCACTGGGAGATCAGGAAAGG - Intronic
992210576 5:74475525-74475547 TCCCACTGGGTGCTCAAGCTGGG - Intergenic
992480310 5:77144667-77144689 TTTCTCTTGGTGATCAGGAAAGG + Intergenic
992780790 5:80125003-80125025 TCTCACTGTGCCATCAGGAATGG - Intronic
993625557 5:90220472-90220494 GCCCACTGGGAAATCAGTAATGG + Intergenic
993823937 5:92657676-92657698 TTCTATTGGTTGATCAGGAAAGG + Intergenic
994447777 5:99899680-99899702 TCCCACTGGCTGAGGATGAAGGG - Intergenic
995856736 5:116600661-116600683 TCCTATGGGGTGATCAGGGAAGG + Intergenic
998016097 5:138733624-138733646 TTAGACTGGGTGGTCAGGAAAGG + Intronic
1000064230 5:157681316-157681338 TCCCACTTGCTCTTCAGGAATGG + Intergenic
1001712997 5:173793030-173793052 TCCAATAGGGTGATCAGGGAAGG + Intergenic
1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG + Intronic
1003334943 6:5161900-5161922 TCTCAAGGGGTGATTAGGAAGGG + Intronic
1003540322 6:7012817-7012839 TCCCAGTGGGAGATAAGAAAAGG - Intergenic
1004610123 6:17232034-17232056 TCCCCTTGGATGATCAGAAAAGG + Intergenic
1007283046 6:40726321-40726343 TACGACAGGGTGACCAGGAAAGG - Intergenic
1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG + Intergenic
1010939185 6:81895954-81895976 TTTGACTTGGTGATCAGGAATGG - Intergenic
1011009425 6:82687062-82687084 TCCCACTGAGTGAACAGGAAGGG - Intergenic
1014208746 6:118686042-118686064 GGCCACTGGGTGACCATGAAAGG + Intronic
1017421457 6:154276991-154277013 TGCCACTGTGTGGTCTGGAAGGG + Intronic
1018795752 6:167184382-167184404 TTCCTCTGGGTGTTCAGGATGGG + Intronic
1018820563 6:167370682-167370704 TTCCTCTGGGTGTTCAGGATGGG - Intronic
1020548573 7:9568118-9568140 TCCCACTGGGTGACCTGAGAAGG + Intergenic
1022303675 7:29126481-29126503 TGCTACTGGTTGATCAGGTAGGG - Intronic
1022621926 7:31993234-31993256 TCATACTGAATGATCAGGAATGG - Intronic
1023609590 7:41959323-41959345 TACCACTGGGTGCTGAGGAAAGG + Intergenic
1023996570 7:45162334-45162356 GCCCACTGGGAGAGAAGGAAAGG + Intronic
1024455872 7:49605679-49605701 TCCCACTAGGTCACCAGCAATGG + Intergenic
1025283835 7:57647319-57647341 TCCCACGGGGTGATCAGGAATGG + Intergenic
1026487136 7:70831104-70831126 TTGCACAGGGTGGTCAGGAATGG + Intergenic
1027290838 7:76708656-76708678 AACCACTGGGTAATTAGGAAGGG + Intergenic
1027345242 7:77252974-77252996 TCCCCCTGTGTGTCCAGGAAGGG + Intronic
1028240924 7:88419500-88419522 TCCCAGTCTGTGATCTGGAATGG + Intergenic
1028608381 7:92680860-92680882 TCCAGCTGGGAGATCAGGAAAGG - Intronic
1029464264 7:100715563-100715585 TCCTGCTGGGAGATCAAGAAAGG + Intergenic
1029508986 7:100981452-100981474 TCCCACTTAGTGAGCAGGCAAGG + Intronic
1029686113 7:102149369-102149391 TCCCACTGGGTAGACAGGAAGGG + Intronic
1029689216 7:102169697-102169719 TCCCACTGGATGACGAGGACAGG - Intronic
1031127787 7:117793919-117793941 TCCCACAGGGTGGTGAGGGAAGG - Intronic
1031273609 7:119688373-119688395 TCCCACAGGGTGATGGAGAATGG + Intergenic
1031358490 7:120817995-120818017 TTGGACTGGGTGATCAGGGAAGG + Intronic
1032878154 7:136059903-136059925 TTAGATTGGGTGATCAGGAAAGG + Intergenic
1032903435 7:136337272-136337294 TCCTACTGGGAGATTAGCAAAGG + Intergenic
1033669893 7:143481741-143481763 TCCCACTGGGTGATCACTCATGG + Intergenic
1035670455 8:1412981-1413003 TCCCACACTGTGGTCAGGAAGGG - Intergenic
1036270849 8:7301509-7301531 TCCCCATGGGGGATCAGGAAAGG - Intergenic
1036350501 8:8008835-8008857 TCCCCATGGGGGATCAGGAAAGG + Intergenic
1036845766 8:12169260-12169282 TCCCCATGGGGGCTCAGGAAAGG + Intergenic
1036867132 8:12411579-12411601 TCCCCATGGGGGCTCAGGAAAGG + Intergenic
1037826393 8:22163024-22163046 TACCACTGGCTGAGTAGGAAAGG + Intronic
1039133408 8:34293523-34293545 CCCTATTGGGTGAACAGGAAAGG + Intergenic
1039832171 8:41224019-41224041 TCCCTGTGGTTGGTCAGGAATGG - Intergenic
1039873475 8:41566762-41566784 ACCCACTGGTTAATCATGAAAGG + Intergenic
1040107831 8:43550234-43550256 TCCCCCTGGGTGATGGGGACAGG - Intergenic
1040110170 8:43563708-43563730 TCCCCCTGGGTGATGGGGACAGG - Intergenic
1041761125 8:61367449-61367471 TTCCACTGGGTCATGAGAAATGG - Intronic
1042312196 8:67390150-67390172 TTGAACTGGGTCATCAGGAATGG + Intergenic
1043512620 8:80964688-80964710 TTCTACTGGGTGGTCAGGGAAGG - Intergenic
1043846823 8:85173232-85173254 GCCCATTCGGTGATCATGAATGG - Intergenic
1044125783 8:88456999-88457021 TCCCACCGGGTGAGAAGGAATGG - Intergenic
1044464943 8:92491901-92491923 TCCCCTGGGTTGATCAGGAAAGG - Intergenic
1044974688 8:97652417-97652439 TCACATAGGGTGATCAGGAAAGG - Intronic
1047610856 8:126519416-126519438 TCTCAATGTGTCATCAGGAAAGG + Intergenic
1047622439 8:126621582-126621604 ACCCACTGGGTGATTACAAAAGG + Intergenic
1047654064 8:126956471-126956493 ACCAACTTGGTGATAAGGAAAGG + Intergenic
1049299486 8:141862083-141862105 TCCCACCGAGTGACCAGGACTGG + Intergenic
1050073901 9:1843984-1844006 TACCTCTGGGTGACTAGGAAGGG + Intergenic
1052902201 9:33802909-33802931 TGGCCCTGGGTGATGAGGAAAGG - Intergenic
1053643173 9:40106962-40106984 TCCCACCCGGTGATCGGGAATGG + Intergenic
1053762977 9:41358528-41358550 TCCCACCCGGTGATCGGGAATGG - Intergenic
1054324026 9:63704190-63704212 TCCCACCCGGTGATCGGGAATGG + Intergenic
1054541582 9:66269641-66269663 TCCCACCCGGTGATCGGGAATGG - Intergenic
1055069082 9:72148470-72148492 TGCCACTTGGTGGTCAGGAAAGG + Intronic
1055309195 9:74961118-74961140 TTCCATTGGGTGCTCAAGAAGGG + Intergenic
1057604612 9:96489916-96489938 TCCCACTGGGATATCGGGAATGG + Intronic
1061701587 9:132420301-132420323 TTCCACTGGGGGAACAGGACAGG + Intronic
1062050999 9:134447043-134447065 TCCCACAGAGTGATCAGAGAGGG + Intergenic
1202790928 9_KI270719v1_random:89932-89954 TCCCACCCGGTGATCGGGAATGG + Intergenic
1186104528 X:6192013-6192035 TCCCATTGGATGAGCATGAATGG - Intronic
1186765897 X:12770347-12770369 TCTCTCCTGGTGATCAGGAAGGG - Intergenic
1187666428 X:21616109-21616131 TCAGACTGGGTTGTCAGGAAAGG - Intronic
1189412976 X:40790385-40790407 TTCCACAGGGTGATGGGGAATGG + Intergenic
1194396217 X:93389637-93389659 TCCCACTTGGTCATGATGAATGG + Intergenic
1194431828 X:93817318-93817340 TCCCACTTGGTCATGAGGAATGG - Intergenic
1195073596 X:101304801-101304823 TCCCATGGGTTGAGCAGGAATGG + Intergenic
1195473558 X:105260100-105260122 TCCCACTCAGTGAGGAGGAATGG + Intronic
1197201730 X:123754325-123754347 TTCCACTGGGGCCTCAGGAAGGG - Intergenic
1197929094 X:131677665-131677687 TCACACTGTGCGATCTGGAAAGG + Intergenic
1198448194 X:136739695-136739717 TTCTCCTGGGTGACCAGGAAAGG + Intronic
1199478723 X:148274178-148274200 TCCCACACAGTGAGCAGGAATGG - Intergenic