ID: 1171554800

View in Genome Browser
Species Human (GRCh38)
Location 20:26072428-26072450
Sequence CTGCAAGGCCTGAGGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 2, 1: 0, 2: 7, 3: 62, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171554795_1171554800 -5 Left 1171554795 20:26072410-26072432 CCACATCCCAGAGACTAGCTGCA No data
Right 1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG 0: 2
1: 0
2: 7
3: 62
4: 333
1171554793_1171554800 5 Left 1171554793 20:26072400-26072422 CCGCCTGGATCCACATCCCAGAG 0: 5
1: 2
2: 7
3: 46
4: 872
Right 1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG 0: 2
1: 0
2: 7
3: 62
4: 333
1171554794_1171554800 2 Left 1171554794 20:26072403-26072425 CCTGGATCCACATCCCAGAGACT 0: 6
1: 2
2: 1
3: 15
4: 215
Right 1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG 0: 2
1: 0
2: 7
3: 62
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171554800 Original CRISPR CTGCAAGGCCTGAGGAAGAA TGG Intergenic
900695065 1:4004671-4004693 CAGCAAAGCCTGAAGAACAAGGG + Intergenic
902739842 1:18429806-18429828 TTGCAGGGCCTCAGGAAAAACGG - Intergenic
903929019 1:26851581-26851603 TTGCCAAGCCTGAGGCAGAAAGG + Intronic
904055090 1:27664872-27664894 CTGCAAAGCCTGTGGCAGAAGGG - Intergenic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
907889970 1:58627460-58627482 CAGCAAACCCTGAGGGAGAAGGG - Intergenic
908313974 1:62914695-62914717 CAGCAAGTCCTGAGGCAGGATGG + Intergenic
908320905 1:62978004-62978026 TTGAAAGGTCTGCGGAAGAAAGG + Intergenic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
909017996 1:70400217-70400239 ATGAAAGGCCAGAGGCAGAAGGG + Intergenic
909339927 1:74520381-74520403 CTGGAGGGGCTGAGGAAGAAAGG - Intronic
909413627 1:75380861-75380883 CTGCCAAACCTGAGGAAGAAGGG + Intronic
909634165 1:77796699-77796721 CTGAAAGGTGTGAGGAAGAAAGG - Intronic
909643022 1:77888308-77888330 CAGCCAGGCCTGGGGAAGGAAGG - Intergenic
911149090 1:94580025-94580047 ATGGAATGCCTGAGGAGGAAGGG - Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
912756714 1:112330222-112330244 ATGGAAGGCTTGAGGAAGACAGG + Intergenic
915402015 1:155629241-155629263 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
916009731 1:160693835-160693857 CTGAAAACCCTGAGGAACAAAGG - Intronic
916010080 1:160697419-160697441 CTGCCAAACCTGAGGAAGAAGGG + Intronic
916736334 1:167610053-167610075 GTACAAGGTCTGAGGCAGAAGGG - Intergenic
917427284 1:174928082-174928104 CTGCAAGGCTGGAGAAGGAAGGG - Intronic
917481945 1:175419826-175419848 CTGCAAAGGCTGAGGGAGAAAGG - Intronic
917852752 1:179079394-179079416 CTCCAAGGCCTGAGACGGAAAGG + Intergenic
918261612 1:182801365-182801387 CAGCAAGGCCTGAGGGAGAGAGG + Intronic
918263134 1:182814831-182814853 GTCCATGGCTTGAGGAAGAACGG - Exonic
919409168 1:197222380-197222402 CTGCAAGTCCTGGCCAAGAAAGG - Intergenic
919988537 1:202692528-202692550 ATGCAAGGCCTGAGTTAGAGTGG - Intronic
920629479 1:207637674-207637696 CTGCCAAACCTGAGGAAGAAGGG - Intronic
920629637 1:207639004-207639026 CTGAAAACCCTGAGGAACAAAGG + Intronic
921412287 1:214848758-214848780 CTGAAAGGCAGGAGGAAGATGGG - Intergenic
923202534 1:231725996-231726018 CTGCAAGGCTGGAGGAGGAAAGG - Intronic
1062936736 10:1395833-1395855 CAGCAAGGCCTGGGGAAGCCGGG - Intronic
1063391419 10:5652263-5652285 GTTCAAGGGGTGAGGAAGAAGGG - Intronic
1063530927 10:6830626-6830648 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1064779839 10:18822927-18822949 ATGAAAGGCCAGAGGAAGGAGGG + Intergenic
1065491373 10:26285000-26285022 TTGCATGGCCTGAGGAATAATGG + Intronic
1066602865 10:37126085-37126107 CTGGGGGGCCTGGGGAAGAAGGG + Intronic
1067785613 10:49243438-49243460 CTGCAAGGAGTGTGGAAGAAAGG + Intergenic
1068837955 10:61576128-61576150 GTCCAAGGGCAGAGGAAGAAGGG - Intergenic
1069113442 10:64474762-64474784 GTGCAAGGACTGAAGAATAAGGG + Intergenic
1069521248 10:69123771-69123793 TTGCGAGGCCTAAGGAAGTAGGG + Exonic
1069720932 10:70548919-70548941 CTGCCAGGCCAGGGGAAGAGTGG + Intronic
1070969210 10:80549686-80549708 CTGCTGGGCCTGAGGAAGGCAGG - Intronic
1072947382 10:99822033-99822055 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1073136252 10:101222253-101222275 CTACAAAGCATGTGGAAGAAGGG - Intergenic
1073470411 10:103718555-103718577 CTGCATGGCCTGGGGAAGTCAGG + Intronic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1077392612 11:2307085-2307107 CTGCAAGGCCTGATGGGGGATGG - Intronic
1077495012 11:2882763-2882785 GTGCAAGGCCTGAAGAAGTCTGG + Intergenic
1078169490 11:8918392-8918414 CTGCAAGGTAGGAGGAAGAGGGG + Intronic
1078562007 11:12380324-12380346 CTCCGAGGCCTGAGGGACAAGGG + Intronic
1079256855 11:18838185-18838207 CTGCTAGCCCTGAGGAATACAGG + Intergenic
1079543363 11:21603020-21603042 CTGCAAGGGCTGATAAAGACAGG + Intergenic
1080424789 11:32145662-32145684 ATTCAATTCCTGAGGAAGAAGGG - Intergenic
1081377060 11:42372513-42372535 TTACAAGGCATCAGGAAGAATGG - Intergenic
1081651547 11:44827352-44827374 CAGCAGGGGCTGAGGGAGAAAGG - Intronic
1083394385 11:62379796-62379818 CTGAAAACCCTGAGGAACAAAGG + Intronic
1084940204 11:72608419-72608441 CTGCAATGGCTGAGCCAGAAGGG - Intronic
1087328140 11:96748017-96748039 CTGAAAGGCTTGATGAAGGAAGG + Intergenic
1087724447 11:101701931-101701953 CTGCCAAACCTGAGGAAGAAGGG + Intronic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089120358 11:116130127-116130149 CCTCAAGGCCTGGGAAAGAAAGG + Intergenic
1089632941 11:119794683-119794705 CTTCCAGGCCTCAGGAAGAGGGG + Intergenic
1089676867 11:120096147-120096169 CTGGAAGGGGTGAGGAAGGAGGG + Intergenic
1090001015 11:122958357-122958379 CTTCAAGGTCTGAGGAAGAAAGG - Intronic
1090040801 11:123289625-123289647 ATGCAAGGCAGGAGGAAGCAAGG + Intergenic
1090422895 11:126587943-126587965 TTGGAAGGCTTTAGGAAGAAGGG + Intronic
1090890055 11:130915652-130915674 CTCCATGCCCTGAGGCAGAAAGG - Exonic
1094233841 12:28139869-28139891 CTGCAATGCTTGAGGTATAATGG + Intronic
1094874566 12:34626423-34626445 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1095428568 12:42107348-42107370 CTGCAGGGCCTGAGTAGGGAAGG + Intronic
1095735887 12:45555771-45555793 CTGGAAGGCAGGAGGAAGAAAGG - Intergenic
1096627444 12:52904325-52904347 CAGAATGACCTGAGGAAGAACGG + Intronic
1097104010 12:56609938-56609960 CTGCAAGCCCTAAGGTAGCAAGG + Exonic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097330731 12:58330034-58330056 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1098236705 12:68424617-68424639 GGGCAAGGCCAGAGGCAGAAGGG + Intergenic
1098311934 12:69157191-69157213 CTGCAAGGCTGGAGGAGGGAAGG - Intergenic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1100397687 12:94199113-94199135 CTGGAAGGCCTCAGTGAGAAGGG + Intronic
1100741766 12:97601688-97601710 CTGCATGCCATCAGGAAGAAGGG + Intergenic
1102490063 12:113285280-113285302 ATGCAAGGCCCAAGGTAGAAGGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104671986 12:130686783-130686805 CTGCAGGGCCGGAGGAGGAAGGG + Intronic
1105289392 13:19039560-19039582 CAGTAAGCCCTGAGGAAGCAGGG - Intergenic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1108738668 13:53312098-53312120 CTCAAAGGATTGAGGAAGAATGG - Intergenic
1109869513 13:68315155-68315177 ATGCAAGGTGTGAGAAAGAAAGG + Intergenic
1110146313 13:72194894-72194916 CTGCAAGGTTTGAGGAAGACGGG + Intergenic
1110473613 13:75887978-75888000 CTGCACGTCCTGAGGCAGAGTGG - Intergenic
1111656227 13:91157152-91157174 TTGCAAGGTCAGAGGAATAAAGG - Intergenic
1112389828 13:98972845-98972867 CAGCAAGGCATGAGGAAGGAAGG - Intronic
1112665785 13:101571586-101571608 GTGCAAGGTTTGAGGAAGAGAGG - Intronic
1112737151 13:102433315-102433337 CTGGAAGGGCAGAGGAAGAAAGG + Intergenic
1113331602 13:109333074-109333096 GTGCAAGGCCAGAGGAGGACCGG - Intergenic
1113830266 13:113290299-113290321 CTGAAGGACGTGAGGAAGAAAGG - Intergenic
1114267317 14:21080646-21080668 CTGCAACACCTGAGGCAGATGGG - Exonic
1115599836 14:34944945-34944967 CTACAAGTGCTGAGGAACAAAGG + Intergenic
1115711717 14:36058164-36058186 CTTAAAGGACTGAGAAAGAAGGG + Intergenic
1115922499 14:38391942-38391964 CTGCACAGGCTGAGGAACAAGGG + Intergenic
1116644880 14:47514590-47514612 CTGCAAGGCATGAGATATAATGG - Intronic
1117073652 14:52079039-52079061 CTGGAAGGCGGGAGGAAGACTGG - Intergenic
1118714739 14:68551093-68551115 TTGCCAGGCCTCCGGAAGAATGG - Intronic
1121880978 14:97500031-97500053 GTGCGAGCCCTGAGGAAGATGGG - Intergenic
1122867455 14:104613712-104613734 CTGCAAGGCCTCTGGTCGAAGGG + Intergenic
1125361956 15:38873769-38873791 CTGCAAAGATTAAGGAAGAACGG - Intergenic
1125796865 15:42409773-42409795 CTCCATGTCCTGAGGAGGAAGGG - Exonic
1125958147 15:43805376-43805398 CTGCATGACTTTAGGAAGAATGG + Exonic
1127959831 15:63882525-63882547 CTGCCAGGCCTGAGGGAGGGAGG - Intergenic
1129078798 15:73021472-73021494 CAGCAGGGCCTGCGGAGGAAGGG + Intergenic
1129736484 15:77968465-77968487 CTGGAAGGCCTGGAGAAGCAAGG - Intergenic
1130868081 15:87949137-87949159 CTGCAAAGAGGGAGGAAGAAGGG + Intronic
1133110362 16:3544466-3544488 CTGCAGGGCCTGTGGAGGAAGGG - Intronic
1133904946 16:10013576-10013598 CAGGAAGGTCTCAGGAAGAAAGG - Intronic
1135607593 16:23836932-23836954 CTGGAGGGACTGGGGAAGAAAGG - Intronic
1136293279 16:29288484-29288506 CTCCACGGCCGGAGGAAGATGGG + Intergenic
1136686038 16:31995539-31995561 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136786650 16:32939068-32939090 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136883119 16:33914722-33914744 CTGCTGGGCCTGGGGATGAAAGG - Intergenic
1136930576 16:34414624-34414646 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1136973998 16:34997184-34997206 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1140074501 16:71684841-71684863 CTGCAAGTCCTGAGGACAAGAGG - Intronic
1140651579 16:77094185-77094207 GTGCTAGGACTGAGGAAGACAGG - Intergenic
1141196882 16:81866890-81866912 CTCCCAGGGCTGAGGCAGAAAGG + Intronic
1141334918 16:83145741-83145763 TTGCAAGACCTGAGGAATAGAGG + Intronic
1141579882 16:84990081-84990103 CTGCAAGGCGTCAGGAACTAGGG + Intronic
1203088887 16_KI270728v1_random:1200738-1200760 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1145304507 17:21666016-21666038 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1146207871 17:30920520-30920542 CTGCCAGGACTGAGCAGGAAGGG - Intronic
1147147001 17:38491207-38491229 CTGCTGGGCCTGGGGATGAAAGG + Intronic
1147644670 17:42026699-42026721 CTGGAAGGCCTGCGAAAGGAGGG + Intronic
1147772428 17:42877249-42877271 CTACAAGACCTGAGGCAGCAGGG - Intergenic
1149029676 17:52068553-52068575 CTACAAGGCTAAAGGAAGAAAGG - Intronic
1150143948 17:62752461-62752483 CTGCCAAGGCTGAGGAAGCAAGG - Intronic
1151368267 17:73630946-73630968 CACCAGGGCCTGAGGAGGAAGGG + Intronic
1151433976 17:74082847-74082869 CGGCAAGGCCTGAGGGAGGGAGG - Intergenic
1152232055 17:79118662-79118684 CTCCAAGGCCTGAGAAAGAGTGG + Intronic
1152259511 17:79259524-79259546 AGGCAAGGCCTGAGGAGGGAAGG + Intronic
1152385261 17:79970263-79970285 CTGCCAGGGCTGGGGAAGGAAGG + Intronic
1152503421 17:80729167-80729189 CAGCAAAGCCTGGGGAAGTATGG - Intronic
1154084159 18:11285909-11285931 CAGCCAGTCCTGTGGAAGAATGG - Intergenic
1154203337 18:12316041-12316063 CTGCCAGGCCTGGGGCAGACTGG - Intronic
1157220584 18:45826152-45826174 GGGCACAGCCTGAGGAAGAAGGG + Intronic
1157294577 18:46433418-46433440 GTGCAGGGCCTGAGGTAGGAAGG - Exonic
1157569469 18:48703094-48703116 CTGCAAGTCCTGAGCTAGCAGGG + Intronic
1158008578 18:52702196-52702218 CTTCAAAGTCTGAGGAAGCAGGG - Intronic
1158250154 18:55479055-55479077 TTGCAATGTTTGAGGAAGAAAGG - Intronic
1158818110 18:61127282-61127304 CTTTAAGGCCTAAAGAAGAAAGG - Intergenic
1160587953 18:79923072-79923094 AAGCAAGGCCAGAGGAAGGATGG + Intronic
1160740156 19:681860-681882 CTGGAAGGACTGAGGAAGGGAGG + Exonic
1160929412 19:1563123-1563145 CTGCAGAGCCCTAGGAAGAAAGG - Intronic
1162830623 19:13282167-13282189 CTGCCAGGCCTGGGAAGGAAGGG + Intronic
1163920029 19:20279667-20279689 CTGAAAACCCTGAGGAACAAAGG - Intergenic
1164154154 19:22579252-22579274 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1164370568 19:27640192-27640214 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1165397531 19:35574043-35574065 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1165606839 19:37113051-37113073 CTGAAAACCCTGAGGAACAAAGG + Intronic
1166228712 19:41413170-41413192 CTGCAAGGCAGGAAGAAGTAGGG + Intronic
1166502715 19:43353522-43353544 CCCGAAGGTCTGAGGAAGAAAGG + Intergenic
1166521269 19:43481828-43481850 AAGCAAGGCCAGAGCAAGAAGGG + Intronic
1167172753 19:47844112-47844134 CTGAAAGGCAAGAGGAAGAATGG - Intergenic
1167367926 19:49064558-49064580 CTCCAGGGTCTGAGGGAGAAGGG - Intronic
1167460197 19:49620894-49620916 CTCCCAGGTCTGAGGAAGGAGGG + Intronic
1167619897 19:50554988-50555010 CTGCAGGGGCTGAGGAAGGGTGG - Intronic
1167746426 19:51353876-51353898 CTCCTGGGTCTGAGGAAGAAGGG - Intronic
1168155878 19:54472811-54472833 CTCCTGGGTCTGAGGAAGAAGGG - Intronic
1168230477 19:55027534-55027556 CTATAAAGGCTGAGGAAGAAAGG + Intronic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
927705550 2:25294371-25294393 TTGGAAGGCATGAGGAAGACAGG - Intronic
928407639 2:31026837-31026859 CTGGGAAGACTGAGGAAGAAAGG - Intronic
929312850 2:40445698-40445720 CTGCATGTCCAGGGGAAGAAAGG + Intronic
929588679 2:43131637-43131659 CAGCAGGGACTGAGGGAGAAGGG - Intergenic
930579778 2:53196173-53196195 CAGCAAGGCCTGAATGAGAAAGG + Intergenic
930752031 2:54943512-54943534 CTACAAGGCCTGAATGAGAAAGG - Intronic
930844650 2:55889069-55889091 CTGCAAGGCCTCAGGGAGGGAGG - Intronic
931224961 2:60321633-60321655 GCGCAAGGCCTGAGGTAGAAGGG - Intergenic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
933026720 2:77268960-77268982 CTGGAAGGCCTGTGCAAAAAAGG - Intronic
933577638 2:84087691-84087713 GTGAAAGCCCTGAGGAAGAAAGG - Intergenic
933691079 2:85180073-85180095 CTGCAAGGACTGTTGGAGAAAGG + Intronic
934045422 2:88169735-88169757 CAGCAAGGTGTGAAGAAGAAAGG - Intergenic
936076943 2:109407539-109407561 CTGCCAGGCCTGAGGCAGGAAGG - Intronic
938121808 2:128639329-128639351 CAGCGAGTCCTGAGGGAGAATGG - Intergenic
938270318 2:129964533-129964555 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
938444130 2:131364034-131364056 CTCCAAGACCTGCGGGAGAAAGG + Intergenic
938689678 2:133776157-133776179 CAGCAAGGCCTGGGGATGGAGGG + Intergenic
938699442 2:133863112-133863134 CTTCCAGTCTTGAGGAAGAAAGG - Intergenic
939164529 2:138626352-138626374 CTGACAGGCCTGAGTAAGCAGGG - Intergenic
939831760 2:147080873-147080895 CTTCAATGCCTGATGAAGCATGG + Intergenic
941439991 2:165522807-165522829 CTGCATGTACTGTGGAAGAAAGG - Intronic
941475171 2:165942552-165942574 AGTGAAGGCCTGAGGAAGAAAGG - Intronic
942084633 2:172432552-172432574 CACCAAGGCCTGAGCAAGGAAGG - Intronic
942615098 2:177783531-177783553 TTGCAGGGCCTCAGGAAAAAAGG - Intronic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
945528540 2:210921102-210921124 CTACAAGGCCAAGGGAAGAAAGG + Intergenic
946299118 2:218811717-218811739 CTGCAGAGGCTGAGGAATAAAGG - Intronic
946341325 2:219071190-219071212 CTTCAAGGCCTGAGGTAGGAGGG + Intergenic
946456053 2:219826949-219826971 CTGCAGGGCCTGAGAAAAAGGGG + Intergenic
1169234811 20:3922468-3922490 GAGCAAAGCCTGAGGAAGCACGG - Intronic
1169733508 20:8812192-8812214 TTCCAAGGCCTGAGGAAGAAGGG - Intronic
1169935624 20:10880461-10880483 TTGCAGGGCCTGAGGCAGGATGG + Intergenic
1170507236 20:17039849-17039871 CTGAAAGTCCTGATGTAGAAAGG - Intergenic
1171487453 20:25494805-25494827 CTGGAAGGCCTGAAGGAGAGTGG + Intronic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171529777 20:25845400-25845422 GTGCAAGGCCTGGGGAAGACTGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1172882384 20:38210566-38210588 CTGCATCCCCTGGGGAAGAAGGG - Exonic
1174182308 20:48682629-48682651 CTCCCAGGCCAGAGGAAGACAGG + Intronic
1174506269 20:51019743-51019765 CTGCAGGGCCTGGGAAAGAGTGG - Intronic
1175146278 20:56898689-56898711 CAGGAAAGCCTGAGGACGAATGG + Intergenic
1175845686 20:62057604-62057626 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845705 20:62057678-62057700 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845724 20:62057752-62057774 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845743 20:62057826-62057848 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845760 20:62057899-62057921 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845778 20:62057973-62057995 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845796 20:62058046-62058068 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845813 20:62058119-62058141 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845831 20:62058193-62058215 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845849 20:62058266-62058288 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845867 20:62058340-62058362 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845885 20:62058414-62058436 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845902 20:62058487-62058509 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845919 20:62058560-62058582 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845937 20:62058634-62058656 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845956 20:62058708-62058730 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845974 20:62058781-62058803 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845991 20:62058854-62058876 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175846008 20:62058927-62058949 CAGCAAGACCTCAGGAAGGACGG + Intronic
1176655827 21:9588443-9588465 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1176827579 21:13714937-13714959 CTGCGCTGCCTGGGGAAGAAAGG + Intergenic
1177248561 21:18563201-18563223 CTGCCAAACCTGAGGAAGAAAGG - Intergenic
1178350459 21:31869664-31869686 ATGCAATGGCTGAGGAAGAAAGG - Intergenic
1180838431 22:18945255-18945277 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1180861529 22:19085449-19085471 CACTATGGCCTGAGGAAGAAAGG + Intronic
1181164786 22:20977430-20977452 CTGCAGGGGCTGAGGAGGTATGG + Intronic
1181611301 22:24014576-24014598 CTGAAAGGCATGAGGAAGAAAGG - Intronic
1183163386 22:36129686-36129708 GTGCAAGGCACGAAGAAGAAGGG + Intergenic
1184295142 22:43518558-43518580 TTCCAAGGCCAGAGGAAGCAAGG - Intergenic
1184300652 22:43557043-43557065 CTTCAGGGCCTGAGGAGGACAGG + Intronic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
949792647 3:7809995-7810017 ATGCTAGGCTTGATGAAGAATGG + Intergenic
950030603 3:9850250-9850272 CTGCCAAACCTGAGGAAGAAGGG - Intronic
950030759 3:9851583-9851605 CTGAAAACCCTGAGGAACAAAGG + Intronic
952146441 3:30537866-30537888 CTGCAAGGGGTAAGGAACAAAGG + Intergenic
953040728 3:39252894-39252916 CTGGAAGGCCTGGGGAGGAGTGG + Intergenic
953680798 3:45036549-45036571 CGGGATGTCCTGAGGAAGAAGGG - Intergenic
953906191 3:46869338-46869360 CTAGACGGGCTGAGGAAGAAAGG + Intronic
954512808 3:51142402-51142424 TTGCTAGGGCTGGGGAAGAAGGG - Intronic
957164028 3:76647328-76647350 CTGAAAGGCTAGAGGAGGAAGGG - Intronic
959070571 3:101698421-101698443 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
960027644 3:113026845-113026867 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
960307470 3:116079282-116079304 TACCAAGGCCTGAAGAAGAAAGG - Intronic
960495067 3:118363306-118363328 CTGCACTGCCTGAGGAATCATGG - Intergenic
961297388 3:125897168-125897190 CTGCCAAACCTGAGGAAGAAAGG + Intergenic
961741117 3:129033737-129033759 GTGACAGGCCTGAGGAAGAGGGG + Intronic
962343594 3:134604369-134604391 CTGCTGAGCCTAAGGAAGAATGG - Exonic
963042036 3:141077163-141077185 CTGGAAGATCTGACGAAGAAGGG - Intronic
964054184 3:152432604-152432626 AGGGAAGGCCTAAGGAAGAATGG + Intronic
967026075 3:185565123-185565145 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
967026896 3:185572597-185572619 CACCAAGGCCTAAGGAAAAAGGG - Intergenic
967723774 3:192842657-192842679 CTGACAGGTCTGAGGAGGAAAGG + Intronic
968705183 4:2074325-2074347 CTGCAGGGCCTGGGGAACCAGGG - Intronic
968812034 4:2804522-2804544 CAGGAAGGCCTGGGGAAGCAGGG - Intronic
969040992 4:4296073-4296095 TTGCAAGGCTTGAGGGAGACAGG + Intronic
969260107 4:6028068-6028090 CACCAAGGCCTGAGGCAGAGGGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969621087 4:8279193-8279215 GAGCAAGGCCTGAGACAGAAGGG - Intronic
970022868 4:11588566-11588588 CTGCAAGGCCTCAGGAATCCAGG + Intergenic
974475561 4:62374768-62374790 ATGGAAGGACAGAGGAAGAAAGG - Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
974773451 4:66446957-66446979 CTCTAAAGCCTTAGGAAGAATGG - Intergenic
975754485 4:77559229-77559251 CTCCAACACCTGGGGAAGAAAGG + Intronic
975760720 4:77617341-77617363 CTCCGAGGCCTGAAGAAGAAAGG + Intergenic
975778659 4:77818407-77818429 TTGGAAGGGCTGAGGAAGAAAGG - Intronic
976078966 4:81333027-81333049 CTCCCAGGCCTGAGCAAGACTGG - Intergenic
976205050 4:82616612-82616634 CTGAAAGGCTGGAAGAAGAAAGG - Intergenic
976219977 4:82748545-82748567 CTGCAATCCCTGAGGCACAAGGG + Intronic
976350172 4:84051855-84051877 CTGCAAAGAGTGAGGAAGAGGGG + Intergenic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977623488 4:99164070-99164092 GTGCAAGGGCTGGGGATGAAGGG - Intergenic
979631058 4:122903678-122903700 CTGCAAGGCTGGAGGAGGAAGGG + Intronic
981859137 4:149333710-149333732 CTGCATGCCATGGGGAAGAATGG + Intergenic
983215496 4:164998663-164998685 CTGAAAACCCTGAGGAACAAAGG - Intergenic
983215687 4:165000314-165000336 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
984717126 4:182936304-182936326 CTGGAACTCCTGAGGAAGTATGG - Intergenic
985940429 5:3131568-3131590 ATGCAAGCCCTGAAGAAGATGGG + Intergenic
986583343 5:9288414-9288436 TTGGAAGGCCTGTGGGAGAAAGG - Intronic
986699840 5:10395681-10395703 CAGGAAGTCCAGAGGAAGAATGG + Intronic
987197087 5:15537521-15537543 CTGCAGGGGATGGGGAAGAACGG - Intronic
987665471 5:20932869-20932891 CTCAAAGGCCTGAGAAACAAAGG - Intergenic
988380197 5:30489220-30489242 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
988614912 5:32765964-32765986 CTGCAAGGCCTGTGGCAGTAGGG + Intronic
988757222 5:34269309-34269331 CTCAAAGGCCTGAGAAACAAAGG + Intergenic
989493992 5:42090188-42090210 CTGGAGTGACTGAGGAAGAATGG - Intergenic
990566763 5:57037506-57037528 CTGCAAGGCCAGAGAAGGGAGGG + Intergenic
991347519 5:65685369-65685391 CAGCAAGGCCTATGGGAGAATGG - Exonic
992648338 5:78833109-78833131 CTGCAAGGCCCCAGCAAGCATGG - Intronic
993691051 5:91000904-91000926 GTTGAAGGCCTGAGGAAAAAAGG - Intronic
995328781 5:110922881-110922903 CAGCAAGGGCAGAGGAACAAAGG - Intergenic
995567536 5:113447037-113447059 CTGCAAAACCTCAGGGAGAAAGG - Intronic
995863210 5:116662773-116662795 CTGCAATGCCTTAGGCAGCATGG - Intergenic
995868826 5:116723414-116723436 CTGCACGGACTGAGCAATAAAGG - Intergenic
996243690 5:121233427-121233449 CTGAAGGGGATGAGGAAGAAAGG + Intergenic
998097869 5:139407200-139407222 CTGCTAGGGCTGAGGACCAAAGG + Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998601978 5:143593810-143593832 CACCAAGGCCTGAGAAAAAAAGG - Intergenic
999232580 5:150070294-150070316 CTGGGGGGTCTGAGGAAGAAAGG + Exonic
999951920 5:156660281-156660303 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1001437961 5:171715172-171715194 CTGTGAGGCCTGAAGAAGGAAGG + Intergenic
1001839880 5:174866103-174866125 CAGCAAACCCTGAGGAAGGAAGG - Intergenic
1001930361 5:175668620-175668642 CTCCAGGACCTGATGAAGAAAGG - Intronic
1002198788 5:177515231-177515253 CTGAGAGGCCTGAAGAAGAAAGG - Exonic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004901267 6:20196424-20196446 TTGCCAGGATTGAGGAAGAAGGG + Intronic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006838381 6:37013105-37013127 CTGCAAGGCCTGAGGCAGGCAGG - Intronic
1007267278 6:40606221-40606243 TAGGAAGGCCTGAGGAAGATGGG - Intergenic
1007640353 6:43334051-43334073 ATTCCAGGACTGAGGAAGAATGG - Intronic
1008819157 6:55609596-55609618 CTGCAAGCTCTGAGGAAGCTGGG + Intergenic
1008876680 6:56337338-56337360 CTGCAAGGCTGGAGAATGAAAGG + Intronic
1009039747 6:58162094-58162116 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1009157402 6:60238408-60238430 GTTCAAGGCCTGTGGTAGAAAGG + Intergenic
1009215642 6:60916940-60916962 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1010011910 6:71057697-71057719 ATGCTAGGCTTGATGAAGAATGG + Intergenic
1010591671 6:77719509-77719531 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1010703143 6:79077159-79077181 GTGCAAGGCCGGAGGAGGAGGGG - Intronic
1013185917 6:107757920-107757942 CTGCGAGGTGTGAGGAAAAAGGG - Intronic
1015691271 6:135926403-135926425 ATGAAAGGCTTGAGGAAGAGTGG + Intronic
1015938492 6:138425787-138425809 CTGGAAGAGCTGAGGAAGACTGG - Intronic
1016040762 6:139429804-139429826 CTGCCAGGCCTGAGGCTGAAAGG + Intergenic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1019330649 7:459013-459035 CTGGAAGGCGGGAGGAAGAGAGG - Intergenic
1019861929 7:3666815-3666837 CTGCAAGACCTGAGATAGGAAGG - Intronic
1019976347 7:4585001-4585023 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1019977283 7:4593505-4593527 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1021524912 7:21576285-21576307 CTGAAAGGCCTCAGCAAGCACGG + Intronic
1022470117 7:30676894-30676916 CTGCCAGGACAGGGGAAGAAGGG - Intronic
1022537740 7:31108311-31108333 TGGCAAAGCCAGAGGAAGAAAGG + Exonic
1022673461 7:32477193-32477215 AAGAAAGGGCTGAGGAAGAAGGG - Intergenic
1023279275 7:38553175-38553197 CTGCAAGGCCGGAAGAGGCAAGG - Intronic
1025302203 7:57826780-57826802 CTGCAAGGCCTGGGGAAGACTGG + Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1025713437 7:63931837-63931859 CTGCAAATCCTGAGAAAGGAAGG + Intergenic
1027926321 7:84468292-84468314 CTGCTAGGTCTTAGGAAGATGGG - Intronic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028746836 7:94336952-94336974 GTGCAAAGCCTGAGGAGGGAAGG - Intergenic
1029147468 7:98457163-98457185 CTGAAAGGCCAGAGGCAGAGTGG + Intergenic
1029688604 7:102165679-102165701 CTGAAAGGCCCCAGGAAGGATGG - Intronic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1032084405 7:128876556-128876578 CTGCAGGGGCTGAGGAACCACGG - Intronic
1032802743 7:135329548-135329570 CAGCAAGGCTAGAGGAAGCAAGG + Intergenic
1032947738 7:136871202-136871224 CCGAAAGGCCTGAGGAAAACTGG + Intronic
1033329201 7:140404114-140404136 CAGCGAGGCAGGAGGAAGAAGGG + Exonic
1034747238 7:153533783-153533805 CTGGAATGGCTGAGGAAGATGGG + Intergenic
1036291895 8:7500450-7500472 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1036561959 8:9905818-9905840 TTGCAGGGGATGAGGAAGAAGGG + Intergenic
1037877855 8:22557172-22557194 CTGTAAGGCCTGAGGCTGCAGGG + Intronic
1038432536 8:27511643-27511665 CTGGAAGGCAGGAGGGAGAATGG + Intronic
1038948385 8:32386694-32386716 CTGCAAGGCCTGGAGAAGTAAGG + Intronic
1039365291 8:36922467-36922489 CTGCAAGGCAAGAGGCAAAAAGG - Intronic
1039887579 8:41663935-41663957 CTGGGAGGCCTGAAGACGAACGG + Intronic
1043308172 8:78823294-78823316 CTCCAAGGCCTGTGATAGAAGGG - Intergenic
1045345935 8:101293569-101293591 CTGCAAAGCCTGAGGCTCAAAGG + Intergenic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1047104670 8:121719863-121719885 CTGCCAGTCCTGTGGAACAAAGG - Intergenic
1048425123 8:134316312-134316334 CTCCAAGACCTAAGGAAGACTGG + Intergenic
1049368795 8:142253673-142253695 TTGCAAGGCCTCAGGCAGGATGG + Intronic
1049772335 8:144389264-144389286 CTCCAAGGCCTGGGGAGGCAAGG - Intronic
1049994002 9:1017539-1017561 CTGCAAGTCCTGGGGAAGACTGG - Intergenic
1051677588 9:19573693-19573715 CTGAAAGACATGGGGAAGAACGG - Intronic
1052479636 9:29007489-29007511 CTGCAAGGTCTGAGAAATATGGG - Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1054554088 9:66636235-66636257 ATGCATTGCCTCAGGAAGAAAGG + Intergenic
1056568139 9:87792891-87792913 AACCAAGGCCTGAGGAAGCAGGG + Intergenic
1056800021 9:89684499-89684521 CTGCAAGCCCTTTGAAAGAAAGG - Intergenic
1057277287 9:93682749-93682771 TTGCAAGGCCTGCGGAAGGAGGG + Intergenic
1057887381 9:98840192-98840214 CTGCAAATCCTGGGCAAGAAAGG + Intronic
1057939562 9:99269481-99269503 AAGGAAAGCCTGAGGAAGAAAGG - Intergenic
1059958786 9:119545195-119545217 CACCAGGGCCTGAGGAAGACAGG - Intergenic
1060150078 9:121282852-121282874 CTGCAGGGTCTGCGGAAGACAGG - Intronic
1061432964 9:130542980-130543002 CTGCAAGGCCCAAGGCAGGAGGG + Intergenic
1062326980 9:136017206-136017228 CTGCAGGTCCTGAGGATGCAGGG - Intronic
1062471746 9:136709152-136709174 CTCCCAGGCCTCAGGACGAATGG + Intergenic
1203633544 Un_KI270750v1:91904-91926 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1185817221 X:3167340-3167362 GTGCAAGGGCTGGGGAAGGAGGG + Intergenic
1185983613 X:4806562-4806584 CTGCAATGCCTGAGAAGCAAGGG + Intergenic
1188031187 X:25266040-25266062 CTGTGAGGCCTGAGGCAAAAGGG - Intergenic
1189615261 X:42776686-42776708 CTGGGAGGACTGAGGAACAAAGG + Intergenic
1190582995 X:51906629-51906651 CTGGAAGGCATCAGAAAGAAAGG + Intergenic
1191100934 X:56727805-56727827 CTGCAAAGGCTGAGAAAGAGTGG - Intergenic
1192363490 X:70453413-70453435 CTGCAAGCCCTCGGGAAGAAGGG + Intronic
1193740986 X:85216638-85216660 CTTCAAGGCCAGCAGAAGAATGG + Intergenic
1195519569 X:105815417-105815439 CTCCAAGGTCAGAGCAAGAAGGG - Intergenic
1195667273 X:107442761-107442783 CTTGAAAGACTGAGGAAGAAAGG - Intergenic
1196224167 X:113146039-113146061 CTGGAAAGTGTGAGGAAGAATGG - Intergenic
1196971978 X:121119706-121119728 CTCCAAGGCCCAAGGTAGAAAGG - Intergenic
1197710528 X:129663476-129663498 CAGCAAAGCAAGAGGAAGAAAGG - Intergenic
1198732057 X:139742135-139742157 ATGCAAGGCCAGGGGAAAAAAGG + Intronic
1199289264 X:146088208-146088230 CTGTAAGGCTTAATGAAGAAGGG + Intergenic