ID: 1171555074

View in Genome Browser
Species Human (GRCh38)
Location 20:26074462-26074484
Sequence GGGCTTCTAACACATCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 3, 2: 4, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171555069_1171555074 10 Left 1171555069 20:26074429-26074451 CCATGCATTCTGGGTAGCAGGGC 0: 2
1: 3
2: 3
3: 11
4: 170
Right 1171555074 20:26074462-26074484 GGGCTTCTAACACATCTTGTAGG 0: 2
1: 3
2: 4
3: 5
4: 97
1171555064_1171555074 25 Left 1171555064 20:26074414-26074436 CCTTGCTACATGAAACCATGCAT 0: 2
1: 5
2: 1
3: 15
4: 145
Right 1171555074 20:26074462-26074484 GGGCTTCTAACACATCTTGTAGG 0: 2
1: 3
2: 4
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171555074 Original CRISPR GGGCTTCTAACACATCTTGT AGG Intergenic
900739561 1:4322420-4322442 GGGCTTCAATCACTTCTGGTGGG - Intergenic
914964934 1:152247576-152247598 GGGTTGCTAACACAGCTTGCAGG + Intergenic
917676488 1:177323553-177323575 GGGCTTCTAAGAGATCATCTTGG - Intergenic
924143861 1:241053718-241053740 GGGCTTCTCCCACAACATGTGGG - Intronic
1065476585 10:26144869-26144891 GGGTTTATAACACAGGTTGTGGG - Intronic
1065787657 10:29231007-29231029 GGGCTTCTCACACATCTTCTTGG + Intergenic
1067775855 10:49164413-49164435 GGGCTTCCAGCACATCTTCCTGG + Intronic
1070618247 10:77986042-77986064 GGGGTTCTAACGCGTCTTGGAGG + Intronic
1073272173 10:102274647-102274669 GGGCTTCTGACACAATTTTTAGG + Intronic
1074071136 10:110070921-110070943 GGCCTACAAACACATCATGTGGG + Intronic
1074171701 10:110945952-110945974 TGGCCTCTTAAACATCTTGTGGG + Intronic
1074475695 10:113772011-113772033 TGGCTTCTGATAAATCTTGTAGG - Exonic
1075080668 10:119381579-119381601 GGGCTTTTAAGACAGGTTGTGGG + Intronic
1075130063 10:119729880-119729902 GGGCTTTTAAAATATCTTTTTGG + Intronic
1076126794 10:127980692-127980714 GGGCTTCAAACACACCTCATGGG + Intronic
1076164574 10:128271438-128271460 GGACTCCTAACCCATCATGTGGG - Intergenic
1092720480 12:11435821-11435843 TGGCTTTTTACACATGTTGTAGG + Intronic
1093046645 12:14454159-14454181 GGGCCTCTAACACCTTTTTTTGG + Intronic
1093580364 12:20779318-20779340 GGGCTTCTAAGAGATCATCTTGG + Intergenic
1094097938 12:26728659-26728681 GGGCTGGTCACACATTTTGTCGG + Intronic
1100690467 12:97033883-97033905 GCTCTTCTAACAAGTCTTGTGGG - Intergenic
1102183544 12:110931163-110931185 GGGCTTCGAACTCAGATTGTCGG + Intergenic
1102793271 12:115666021-115666043 AGGCATTTAACACATCTGGTAGG + Intergenic
1104203173 12:126611932-126611954 GGGCTGTCACCACATCTTGTAGG + Intergenic
1111181273 13:84669096-84669118 GTGCTTTTAACACATTTAGTAGG + Intergenic
1116295239 14:43099411-43099433 GGGCTTGTAAAACATTTAGTGGG + Intergenic
1135752897 16:25070968-25070990 GGGTTTCCAACTCATCTAGTAGG + Intergenic
1137698304 16:50477617-50477639 GGGCTGCCACCACATCTTCTGGG - Intergenic
1141102629 16:81209196-81209218 GGGCATCTAACAGATCTCGCTGG - Intergenic
1145304211 17:21663771-21663793 GGGCATCTAACACATCTTGTAGG - Intergenic
1153752193 18:8244228-8244250 TGGCTTCTAACACATCTCCTTGG + Intronic
1159507470 18:69355923-69355945 AGGCTTATAAGACATCATGTGGG - Intergenic
1162840598 19:13353735-13353757 GGGAATCAAACACATCCTGTAGG + Intronic
1167095574 19:47373409-47373431 GGGCATCTAACCCAGTTTGTGGG + Intronic
926867287 2:17373797-17373819 GCGATTCTACCACATCTTTTTGG - Intergenic
928305524 2:30167270-30167292 GCTGTTCTAACACACCTTGTGGG - Intergenic
932882003 2:75511170-75511192 GGGCTTCTCATATATCTTTTAGG + Intronic
937290163 2:120777300-120777322 CGGCTTCTCACACATCTCCTTGG - Intronic
939038746 2:137163263-137163285 GGGATTTGAACACATCTTTTTGG - Intronic
940031122 2:149262477-149262499 GAGGTTCTAATACATTTTGTAGG + Intergenic
941243635 2:163070796-163070818 GGACTTCTAAGAGATCTTCTCGG - Intergenic
943736014 2:191355529-191355551 GGACTACTAACACATCTACTTGG - Intronic
945857656 2:215087654-215087676 GGGCTCCTAATACAACTTGGTGG + Intronic
1171521767 20:25781589-25781611 GGGCTTCTAACACATCTTGTAGG - Intronic
1171555074 20:26074462-26074484 GGGCTTCTAACACATCTTGTAGG + Intergenic
1172303056 20:33863241-33863263 GGGCTGCTAGCTCATCTTCTAGG + Intergenic
1174216248 20:48918849-48918871 GGGCCTCTATCACACCTTGTTGG + Intergenic
1176655565 21:9586500-9586522 GGGCATCTAACACATCTTGTAGG - Intergenic
1182850987 22:33474110-33474132 GGGCCTCAAACATATATTGTTGG + Intronic
1185080363 22:48706278-48706300 AGGCTTGGAACTCATCTTGTTGG - Intronic
953664401 3:44915694-44915716 GGGCTTCAAACTCCTCTTCTAGG - Intronic
953688596 3:45098031-45098053 GGGCTTCTAACACGGCTTTGGGG - Intronic
958501754 3:94919633-94919655 GGTCTTTTAGCAAATCTTGTAGG - Intergenic
964830176 3:160875485-160875507 AGGATCCTAACACATCTTTTGGG + Intronic
964916618 3:161848783-161848805 GGACTTCTAAGAGATCTTCTTGG + Intergenic
966169988 3:177069261-177069283 GGTCTTCTAATACATTTTTTAGG - Intronic
966317624 3:178666663-178666685 GGGCATTTAACAGATCTTTTTGG - Intronic
969931578 4:10636127-10636149 GGACTCCCAACACATCTTTTTGG - Intronic
972991007 4:44822587-44822609 GGGGTTAAAACACATCATGTTGG + Intergenic
974263051 4:59549542-59549564 GAGCTTCTAACATCTCTTTTTGG + Intergenic
981211329 4:142109498-142109520 AGGCTTCCAAAACCTCTTGTGGG + Intronic
989002657 5:36777037-36777059 GAGCTTATATCACATCTTGTAGG - Intergenic
989085108 5:37667724-37667746 GGGCTTATAATACATATTTTAGG - Intronic
990707400 5:58544821-58544843 GAACTTGTAAAACATCTTGTGGG - Intronic
991004301 5:61812662-61812684 GGGCTTCTGCCAAATCTTGAAGG - Intergenic
992400432 5:76405985-76406007 GGGCTTTAAACACAACTTTTTGG + Intronic
994602613 5:101925862-101925884 GTGCTTCTAAGAGATTTTGTAGG + Intergenic
999360371 5:150980667-150980689 GAGCTCTTAACACCTCTTGTAGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1005361321 6:25033726-25033748 AGGCTCCCAACACATCCTGTAGG + Intronic
1008030394 6:46688121-46688143 GGGCGTCGAGCACATCTTGACGG - Exonic
1009564261 6:65291916-65291938 GGGCTTTCAAGACATATTGTAGG - Intronic
1011606441 6:89110804-89110826 GGAATTCTAACACATGTTTTTGG - Intronic
1013620202 6:111880354-111880376 GGATTTATGACACATCTTGTAGG + Intergenic
1018140326 6:160827275-160827297 GGGCTTTCAAGACATATTGTAGG - Intergenic
1024647261 7:51380935-51380957 TCGCTTCTAAGACATTTTGTAGG - Intergenic
1024800954 7:53077357-53077379 GGGCTGTTGATACATCTTGTTGG + Intergenic
1024944620 7:54796347-54796369 GGGCCTCTAAACCATTTTGTGGG + Intergenic
1025282215 7:57636367-57636389 GGGCATCTAACACATCTTGGGGG - Intergenic
1025302515 7:57829152-57829174 GGGCATCTAACACATCTTGGGGG + Intergenic
1030734824 7:113035294-113035316 GGACTTCAAACAGCTCTTGTTGG - Intergenic
1030882687 7:114900810-114900832 AGGCTTCTAACAGTTCTTGGAGG + Intergenic
1032323316 7:130903549-130903571 GGGCTCCCAACACATGGTGTTGG + Intergenic
1033222256 7:139536002-139536024 GGGCTTTAAACACAGCTTGTTGG + Intronic
1035738376 8:1906436-1906458 AGGCTCCTAACACATCGTGTTGG - Intronic
1036694233 8:10964280-10964302 GGGCTTCTAGGACACCTTCTAGG + Intronic
1036999634 8:13703105-13703127 GGGATTCTCAGACATCCTGTGGG + Intergenic
1038931004 8:32193662-32193684 GGGATTCTAACGTATCTTTTTGG - Intronic
1039692833 8:39880506-39880528 GGACTTCTAACAGATCATCTTGG + Intergenic
1046517144 8:115277243-115277265 GGGCTTATTACACATATTTTTGG - Intergenic
1047049743 8:121097590-121097612 GGTCTGCTGACTCATCTTGTTGG - Intergenic
1050302991 9:4277651-4277673 GGGCTTCTGACATTTCTTGCTGG - Intronic
1051714236 9:19964738-19964760 GGGCTGCTAACTCACTTTGTTGG + Intergenic
1053238647 9:36478096-36478118 GTGCTTCTAAGAAGTCTTGTTGG - Intronic
1057855693 9:98599290-98599312 GGGCTTCTAGCACATTTTGTTGG + Intronic
1060054676 9:120403251-120403273 GGGCTTATGAGTCATCTTGTAGG + Intronic
1060228510 9:121810625-121810647 GGCCCTCTCACACATCTGGTGGG + Intergenic
1060243488 9:121925286-121925308 ATGCTACTAACACCTCTTGTGGG + Intronic
1060676390 9:125519130-125519152 TGGCTCCTCACACATCATGTAGG + Intronic
1203633283 Un_KI270750v1:89972-89994 GGGCATCTAACACATCTTGTAGG - Intergenic
1187650914 X:21404866-21404888 GGCGTTCTAACACAACTTATGGG + Intronic
1192122170 X:68466708-68466730 GGGCTGATAGCATATCTTGTTGG + Intergenic
1198550199 X:137737107-137737129 CTCCTTCTAACAGATCTTGTGGG - Intergenic
1200711459 Y:6488352-6488374 GGACTTCTAAGAGATCTTCTTGG - Intergenic
1201022474 Y:9673635-9673657 GGACTTCTAAGAGATCTTCTTGG + Intergenic
1201073456 Y:10170099-10170121 GAGCTTCCAACACATCTGGCCGG - Intergenic
1201639940 Y:16167884-16167906 GGACTTCTAAGAGATCTTTTCGG + Intergenic
1201648691 Y:16262855-16262877 GGGCTTCTAAGAGATCCTCTTGG + Intergenic
1201654118 Y:16322445-16322467 GGGCTTCTAAGAGATCCTCTTGG - Intergenic
1201662873 Y:16417441-16417463 GGACTTCTAAGAGATCTTTTCGG - Intergenic
1201885586 Y:18878401-18878423 GGGCTTTAACCACATCTTCTAGG + Intergenic