ID: 1171555750

View in Genome Browser
Species Human (GRCh38)
Location 20:26081506-26081528
Sequence GGCCGCCTGAACCTCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171555750_1171555759 16 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555759 20:26081545-26081567 CTGTGAGTGATGCCTCCTTGGGG No data
1171555750_1171555757 14 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555757 20:26081543-26081565 GGCTGTGAGTGATGCCTCCTTGG No data
1171555750_1171555753 -7 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555753 20:26081522-26081544 GGCGGCCCCGGTGTCGCAAGCGG No data
1171555750_1171555761 25 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555761 20:26081554-26081576 ATGCCTCCTTGGGGCCGGAGTGG No data
1171555750_1171555760 20 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555760 20:26081549-26081571 GAGTGATGCCTCCTTGGGGCCGG No data
1171555750_1171555758 15 Left 1171555750 20:26081506-26081528 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1171555758 20:26081544-26081566 GCTGTGAGTGATGCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171555750 Original CRISPR GGCCGCCTGAACCTCCGCCA GGG (reversed) Intergenic
No off target data available for this crispr