ID: 1171557968

View in Genome Browser
Species Human (GRCh38)
Location 20:26095546-26095568
Sequence GTCAGCAATGCTACTACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171557968_1171557974 5 Left 1171557968 20:26095546-26095568 CCCCCTGTAGTAGCATTGCTGAC No data
Right 1171557974 20:26095574-26095596 TGCCTTGTTCTTTCACCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171557968 Original CRISPR GTCAGCAATGCTACTACAGG GGG (reversed) Intergenic
No off target data available for this crispr