ID: 1171562925

View in Genome Browser
Species Human (GRCh38)
Location 20:26144159-26144181
Sequence TAGAAGGGCTGGAGGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171562919_1171562925 2 Left 1171562919 20:26144134-26144156 CCTCATGGATGGTATGAGTGTGT No data
Right 1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171562925 Original CRISPR TAGAAGGGCTGGAGGGAATT AGG Intergenic
No off target data available for this crispr