ID: 1171572147

View in Genome Browser
Species Human (GRCh38)
Location 20:26262882-26262904
Sequence CAGTAAAAGTATTTTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171572144_1171572147 8 Left 1171572144 20:26262851-26262873 CCTCCTCAGTAAATAAGACATGG No data
Right 1171572147 20:26262882-26262904 CAGTAAAAGTATTTTGAGTCTGG No data
1171572146_1171572147 5 Left 1171572146 20:26262854-26262876 CCTCAGTAAATAAGACATGGAAT No data
Right 1171572147 20:26262882-26262904 CAGTAAAAGTATTTTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171572147 Original CRISPR CAGTAAAAGTATTTTGAGTC TGG Intergenic
No off target data available for this crispr