ID: 1171572147 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:26262882-26262904 |
| Sequence | CAGTAAAAGTATTTTGAGTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171572144_1171572147 | 8 | Left | 1171572144 | 20:26262851-26262873 | CCTCCTCAGTAAATAAGACATGG | No data | ||
| Right | 1171572147 | 20:26262882-26262904 | CAGTAAAAGTATTTTGAGTCTGG | No data | ||||
| 1171572146_1171572147 | 5 | Left | 1171572146 | 20:26262854-26262876 | CCTCAGTAAATAAGACATGGAAT | No data | ||
| Right | 1171572147 | 20:26262882-26262904 | CAGTAAAAGTATTTTGAGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171572147 | Original CRISPR | CAGTAAAAGTATTTTGAGTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||