ID: 1171720486

View in Genome Browser
Species Human (GRCh38)
Location 20:28557600-28557622
Sequence CAGGGAATACAGATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171720486_1171720489 15 Left 1171720486 20:28557600-28557622 CCATGCACAATCTGTATTCCCTG No data
Right 1171720489 20:28557638-28557660 AAATCTAATTCTCACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171720486 Original CRISPR CAGGGAATACAGATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr