ID: 1171721762

View in Genome Browser
Species Human (GRCh38)
Location 20:28570300-28570322
Sequence AAGTCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171721762_1171721766 18 Left 1171721762 20:28570300-28570322 CCTTCACTCTTCTAGAAGGACTT No data
Right 1171721766 20:28570341-28570363 TCCATGGTTTAGAATATAAGAGG No data
1171721762_1171721763 2 Left 1171721762 20:28570300-28570322 CCTTCACTCTTCTAGAAGGACTT No data
Right 1171721763 20:28570325-28570347 TTTGATAGTCCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171721762 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr