ID: 1171732122

View in Genome Browser
Species Human (GRCh38)
Location 20:28718936-28718958
Sequence GGCTGCATAGTATTTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171732122_1171732129 26 Left 1171732122 20:28718936-28718958 CCCATGGGAAATACTATGCAGCC No data
Right 1171732129 20:28718985-28719007 TTTAGGGACATGGATGAAATTGG 0: 73
1: 8384
2: 3599
3: 9806
4: 11093
1171732122_1171732127 16 Left 1171732122 20:28718936-28718958 CCCATGGGAAATACTATGCAGCC No data
Right 1171732127 20:28718975-28718997 TCATATCCTTTTTAGGGACATGG No data
1171732122_1171732126 10 Left 1171732122 20:28718936-28718958 CCCATGGGAAATACTATGCAGCC No data
Right 1171732126 20:28718969-28718991 ATGAGTTCATATCCTTTTTAGGG No data
1171732122_1171732125 9 Left 1171732122 20:28718936-28718958 CCCATGGGAAATACTATGCAGCC No data
Right 1171732125 20:28718968-28718990 GATGAGTTCATATCCTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171732122 Original CRISPR GGCTGCATAGTATTTCCCAT GGG (reversed) Intergenic
No off target data available for this crispr