ID: 1171749047

View in Genome Browser
Species Human (GRCh38)
Location 20:29029437-29029459
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171749041_1171749047 23 Left 1171749041 20:29029391-29029413 CCATGAACATTCAAAGAAAGAAG No data
Right 1171749047 20:29029437-29029459 GCCCCACGGGACCTGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171749047 Original CRISPR GCCCCACGGGACCTGAGTGA AGG Intergenic
No off target data available for this crispr