ID: 1171750029

View in Genome Browser
Species Human (GRCh38)
Location 20:29039715-29039737
Sequence TTCCTGCCACCTCATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171750029_1171750034 -1 Left 1171750029 20:29039715-29039737 CCTTCTTCATGAGGTGGCAGGAA No data
Right 1171750034 20:29039737-29039759 AGGAGAAGCACAAGCAAAGGGGG No data
1171750029_1171750031 -4 Left 1171750029 20:29039715-29039737 CCTTCTTCATGAGGTGGCAGGAA No data
Right 1171750031 20:29039734-29039756 GGAAGGAGAAGCACAAGCAAAGG No data
1171750029_1171750033 -2 Left 1171750029 20:29039715-29039737 CCTTCTTCATGAGGTGGCAGGAA No data
Right 1171750033 20:29039736-29039758 AAGGAGAAGCACAAGCAAAGGGG No data
1171750029_1171750032 -3 Left 1171750029 20:29039715-29039737 CCTTCTTCATGAGGTGGCAGGAA No data
Right 1171750032 20:29039735-29039757 GAAGGAGAAGCACAAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171750029 Original CRISPR TTCCTGCCACCTCATGAAGA AGG (reversed) Intergenic
No off target data available for this crispr