ID: 1171753335

View in Genome Browser
Species Human (GRCh38)
Location 20:29077099-29077121
Sequence GTAGCTATTCTGACTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171753329_1171753335 26 Left 1171753329 20:29077050-29077072 CCTTTTCTCCACAGCCTCCCAAG No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data
1171753332_1171753335 9 Left 1171753332 20:29077067-29077089 CCCAAGATCTGTTGTTTTTCGAT No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data
1171753330_1171753335 18 Left 1171753330 20:29077058-29077080 CCACAGCCTCCCAAGATCTGTTG No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data
1171753331_1171753335 12 Left 1171753331 20:29077064-29077086 CCTCCCAAGATCTGTTGTTTTTC No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data
1171753328_1171753335 27 Left 1171753328 20:29077049-29077071 CCCTTTTCTCCACAGCCTCCCAA No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data
1171753333_1171753335 8 Left 1171753333 20:29077068-29077090 CCAAGATCTGTTGTTTTTCGATT No data
Right 1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171753335 Original CRISPR GTAGCTATTCTGACTGGTAT AGG Intergenic
No off target data available for this crispr