ID: 1171754702

View in Genome Browser
Species Human (GRCh38)
Location 20:29093468-29093490
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1274
Summary {0: 5, 1: 5, 2: 38, 3: 217, 4: 1009}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171754699_1171754702 5 Left 1171754699 20:29093440-29093462 CCAGTAGAAAAATTGCGAACAAT No data
Right 1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG 0: 5
1: 5
2: 38
3: 217
4: 1009
1171754697_1171754702 7 Left 1171754697 20:29093438-29093460 CCCCAGTAGAAAAATTGCGAACA No data
Right 1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG 0: 5
1: 5
2: 38
3: 217
4: 1009
1171754698_1171754702 6 Left 1171754698 20:29093439-29093461 CCCAGTAGAAAAATTGCGAACAA No data
Right 1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG 0: 5
1: 5
2: 38
3: 217
4: 1009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171754702 Original CRISPR CTGAATAGAAAAATGGACAA GGG Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900698749 1:4030272-4030294 CTGAAAAGGAAAATGGAAACAGG - Intergenic
900961098 1:5920654-5920676 CAGAAAAGAAAAATGGGCAAAGG - Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901377619 1:8850762-8850784 CTCAATTCAAAAATGGGCAAAGG + Intergenic
901600504 1:10419825-10419847 CTGAACAGAAAATAGGGCAAAGG - Exonic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
904318900 1:29683842-29683864 CAGAAGACAAAAATGCACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
905459106 1:38110244-38110266 CTCATTAGAAAAATGGGCAAAGG + Intergenic
905593162 1:39182522-39182544 CCCAATAAAAAAATGGGCAAAGG + Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906664618 1:47611238-47611260 CTCAATAGAAAAATTGGCAAAGG + Intergenic
906842115 1:49150438-49150460 ATGCATAGAAAAAAAGACAAAGG + Intronic
907279337 1:53335670-53335692 CCCAATTGAAAAATGGGCAAAGG - Intergenic
907532479 1:55115060-55115082 CTCCATCGAAAAATGGGCAAAGG + Intronic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908223049 1:62027806-62027828 CTCATTAAAAAAATGGGCAAGGG - Intronic
908464767 1:64382600-64382622 GTGACAAGAAAAATAGACAAGGG + Intergenic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
908696690 1:66850511-66850533 CTGAAAGGAAAAAAGAACAATGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909085092 1:71161262-71161284 CTGAATAGAACAAAAGGCAAAGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909684390 1:78330175-78330197 ATAACTTGAAAAATGGACAAAGG + Intronic
909959139 1:81817124-81817146 CAGAATAGAAAAACAGACACTGG - Intronic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
910159909 1:84261546-84261568 CTGATTTAAAAAATGGGCAAAGG + Intergenic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910385375 1:86676993-86677015 CTCAATGGAAAAATGGATAGAGG + Intergenic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911016048 1:93333943-93333965 CCAAACAGAAAAATGGGCAAAGG - Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911614671 1:99996372-99996394 CTTAATAGAAAAGGGGGCAAAGG + Intronic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
911846236 1:102754767-102754789 CCAAATAGAAAAATGCACAATGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913458078 1:119054212-119054234 CTCGATTGAAAAATGGGCAAAGG + Intronic
913534264 1:119756315-119756337 CCTAATAGAAAAATGAGCAAAGG - Intronic
914325340 1:146609442-146609464 CACAATAGAAAAATGGGCAAAGG - Intergenic
914399462 1:147304182-147304204 AAGAATAAAAAAGTGGACAAAGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
915012390 1:152699452-152699474 AAGAATAGAAGAATTGACAATGG - Intergenic
915077704 1:153324060-153324082 TCAAATAGAAAAATGGGCAAAGG + Intergenic
915153166 1:153851601-153851623 ATTAAAAAAAAAATGGACAAAGG - Intronic
915184177 1:154090508-154090530 CTGATTCAAAAAATGGGCAAAGG + Intronic
916150871 1:161788382-161788404 CTGAGTAGAAAAACTGGCAAAGG - Intronic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
916453430 1:164944293-164944315 CCTGATTGAAAAATGGACAAAGG - Intergenic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
916778346 1:167993786-167993808 CTGAATTGAATAAAGGACATGGG - Intronic
916835686 1:168542734-168542756 CTGAAAAGAAAGAAGGCCAAAGG + Intronic
916838927 1:168579415-168579437 CTGAAAGGAAAGATGGCCAAAGG - Intronic
917002816 1:170378777-170378799 CTCAATTCAAAAATGGGCAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
918231221 1:182534426-182534448 ACCAATAGAAAAATAGACAAAGG - Intronic
918420330 1:184358247-184358269 CTCAATAGAAAGATTGGCAAAGG + Intergenic
918520342 1:185407952-185407974 AGGAGTACAAAAATGGACAAGGG - Intergenic
918583172 1:186156366-186156388 CTCAGTAGAAAAATGCATAAGGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919192270 1:194237520-194237542 CCCAATTGAAAAATGGGCAAAGG + Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920164464 1:204025954-204025976 GTGAATACAAAAGTGAACAAGGG + Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922278205 1:224098955-224098977 CAGAGTAGAATAATGGACACTGG + Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922631508 1:227118220-227118242 CTCAATCAAAAAATGGGCAAAGG + Intronic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923480873 1:234382201-234382223 CTGGATCGAAAAGTGGACCAGGG + Intronic
923716940 1:236433231-236433253 ATGCATACAAAAATGTACAAAGG - Intronic
923732209 1:236563109-236563131 CTGAATAGAAACAATGACAGAGG + Intronic
923760564 1:236839348-236839370 CCCAGTAGGAAAATGGACAAAGG + Intronic
923829249 1:237536944-237536966 CCAAATAGAAAAATGAGCAAAGG + Intronic
924209908 1:241754067-241754089 CAGATTAGAAAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
924810534 1:247397429-247397451 CAGAAAAGAAAAATACACAAAGG - Intergenic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1062780043 10:194726-194748 CTCCATAAAAAAATGGGCAAAGG - Intronic
1062840055 10:663231-663253 ATGAATAGAAAGATCTACAAGGG + Intronic
1063621477 10:7652868-7652890 CACAATAGAAAGATGGGCAAAGG + Intronic
1064157157 10:12912443-12912465 CTGATTTAAAAAATGGGCAAAGG - Intronic
1064772357 10:18736482-18736504 CCCATTAAAAAAATGGACAAAGG + Intergenic
1064778727 10:18809284-18809306 TTTCAGAGAAAAATGGACAATGG + Intergenic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1065198752 10:23293390-23293412 CTCATTAGCAAAATGAACAAAGG + Intronic
1065228502 10:23572147-23572169 CAGAAGAGAAAAAAGGAAAAAGG + Intergenic
1065401646 10:25309378-25309400 CTGAATTCAAAAGTGGGCAAAGG - Intronic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1065835546 10:29654911-29654933 CTGGATAGAAAAAAAGACAGGGG - Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1066384458 10:34930378-34930400 ATGAATAGAATAATAGACATTGG - Intergenic
1066466535 10:35655440-35655462 GAGAAAAAAAAAATGGACAAAGG - Intergenic
1066618043 10:37315849-37315871 ATGAATAGAAAAACAGAGAAAGG - Intronic
1066651715 10:37662211-37662233 AAAAATAGAAAAATGGGCAAAGG + Intergenic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066678331 10:37912165-37912187 CTGGTTAAAAAACTGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067035481 10:42912509-42912531 AAAAATAGAAAAATGGGCAAAGG + Intergenic
1067174385 10:43932666-43932688 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1067457293 10:46428059-46428081 CTGAAAAAGAAAATGGCCAATGG + Intergenic
1067629909 10:47956579-47956601 CTGAAAAAGAAAATGGCCAATGG - Intergenic
1067699619 10:48559699-48559721 CCCAATAGAAAAGTGGATAAGGG - Intronic
1067699958 10:48563915-48563937 CCCAATAGAAAAATGGGTAAAGG + Intronic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068043022 10:51850663-51850685 CCTAACAGAAAAATGGGCAAAGG + Intronic
1068476624 10:57535359-57535381 CTAAATAGAACAAAGGGCAAAGG + Intergenic
1068852998 10:61765986-61766008 ACGAATAGAAAAATTGAAAAAGG + Exonic
1068968791 10:62940625-62940647 CTGAATAGAAAAGATGAGAAAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070357014 10:75649943-75649965 CTCAATTCAAAAATGGGCAAAGG - Intronic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070873861 10:79783198-79783220 ATCAACAGATAAATGGACAAAGG - Intergenic
1071040560 10:81303797-81303819 CTCCATTGAAAAATGGGCAAAGG + Intergenic
1071128410 10:82363170-82363192 CTCAATAGGGAAATTGACAAAGG + Intronic
1071155342 10:82681992-82682014 CTGAATAGAACACTGGGCAAGGG + Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071542157 10:86495811-86495833 CTCAATTCAAAAATGGGCAAAGG + Intronic
1071640794 10:87305337-87305359 ATCAACAGATAAATGGACAAAGG - Intergenic
1071654442 10:87432599-87432621 ATCAACAGATAAATGGACAAAGG + Intergenic
1072177719 10:92945194-92945216 CTGAATTAAAAAGTGGGCAAAGG - Intronic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1072270948 10:93775806-93775828 CTGATTTGAAAAATGGCCCAAGG - Intronic
1072370292 10:94759268-94759290 TTGATTAAAAAAATGGGCAACGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1074758811 10:116648651-116648673 CCCAACAGAAAAATGGACAGAGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1076044697 10:127282349-127282371 CTGGATGGAAAAGAGGACAAAGG + Intronic
1076284777 10:129283495-129283517 CTGAAAAGAAAATGAGACAAAGG + Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1077345225 11:2045245-2045267 GAGAATGGAAAAATGGAGAATGG - Intergenic
1077666731 11:4117004-4117026 CCAAATAGAAACATGGGCAAGGG + Intronic
1077670842 11:4156047-4156069 CCCAATTGAAAAATGGCCAAAGG - Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1077765005 11:5148756-5148778 CAAATTAGAAAAATGAACAAAGG + Intergenic
1077766554 11:5164862-5164884 CTCACCAGAAAAATGGGCAAGGG + Intronic
1078039522 11:7846641-7846663 CCTAATAGAAAAATTCACAAAGG + Intergenic
1078553473 11:12297347-12297369 ACCAATAGAAAACTGGACAAAGG - Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078656152 11:13242003-13242025 CTCAATAGATCAATGGCCAAAGG - Intergenic
1079012215 11:16838158-16838180 CTCAGTAGAAAAATGGGCAGAGG + Intronic
1079259713 11:18866719-18866741 CTGAAAAGGAAAATGGATATGGG - Intergenic
1080325865 11:31072266-31072288 TTCAATACAAAAATGGGCAAAGG - Intronic
1080552534 11:33386116-33386138 CTGAATAGAAATAGGGAGAGTGG + Intergenic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081166848 11:39818360-39818382 CTGAAGTGAAGAAGGGACAAAGG - Intergenic
1081264815 11:41007230-41007252 CTCAATGGAAAAATAGGCAAAGG + Intronic
1081392531 11:42545810-42545832 CTAAAGAGAAAAATAAACAAGGG - Intergenic
1081524342 11:43914828-43914850 CCCCATAGAACAATGGACAAAGG + Intronic
1081763572 11:45593724-45593746 CTCAATAGGAATATGGGCAATGG + Intergenic
1082209344 11:49479199-49479221 CTGAATAGAAGTATGGGAAATGG - Intergenic
1082565344 11:54670895-54670917 CTCAATCAAAAAGTGGACAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083538490 11:63493317-63493339 CTCCAAAGAAAAATGGGCAAAGG - Intergenic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085021151 11:73209309-73209331 CTTAATAGAAAAATGGCTAAAGG + Intergenic
1085041623 11:73330088-73330110 CCCAACAGAAAAATAGACAAAGG - Intronic
1085219783 11:74864270-74864292 CTGGATAGAAGAATGGACCCAGG + Intronic
1085330773 11:75648754-75648776 CTGAATAGGACAATGGGAAAGGG + Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085453414 11:76652209-76652231 CTCAGTAGAAAAATGGGCAAAGG + Intergenic
1085787381 11:79465697-79465719 ATTAGTAGGAAAATGGACAAAGG + Intergenic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1086056938 11:82658052-82658074 CTCTATAAAAAAATGGGCAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087578613 11:100023885-100023907 CTGAATAGATAAATGAACTGTGG - Intronic
1087913463 11:103780275-103780297 CTGAATTGAAACATGGAAAGAGG + Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088393845 11:109345636-109345658 AGGAATAGAAAAATTAACAAAGG - Intergenic
1089273758 11:117319216-117319238 CCTGATAGAAAAATGAACAAAGG + Intronic
1089718399 11:120387103-120387125 CTGAATAGAATCATGAACCAAGG - Intronic
1089726583 11:120485867-120485889 CTCAATAGAAAAGACGACAATGG - Exonic
1089985241 11:122806386-122806408 TGTAATAGAAAAATGAACAAAGG - Intronic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090340211 11:126011546-126011568 CCCAATAGAAAAACTGACAAAGG - Intronic
1090510834 11:127373306-127373328 CTGAATAGAAAATAGGGCATGGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092016630 12:5164609-5164631 CTGAAGAGAAGTATGGAAAAAGG - Intergenic
1092485006 12:8895467-8895489 CCCAAAAGAAAAATGGGCAAAGG - Intergenic
1092633206 12:10408328-10408350 CTGAATAGAAGAATGCAGAAAGG - Exonic
1092838358 12:12514262-12514284 CTGGAAAGAACAATGGACTAGGG - Intronic
1093259666 12:16919486-16919508 CCCAATTGAAAAATGAACAAAGG + Intergenic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1094101260 12:26766444-26766466 CCCAATTGAAAAATGGACAGAGG - Intronic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094486754 12:30931332-30931354 CTCAGAAGAAAAAAGGACAAAGG + Intronic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095641516 12:44491171-44491193 CAGAAGAGAAAACTGGAAAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095734045 12:45536792-45536814 CTAAATAGAAAAATGGTAAGTGG - Intergenic
1095813274 12:46394423-46394445 CCCAATAGAAAAATGGGTAAAGG + Intergenic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1097699797 12:62808419-62808441 TAGAGTAGAAAAATGGACTATGG - Intronic
1097744576 12:63287024-63287046 CAGAACAGAAACATGGACTATGG - Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1098448672 12:70594320-70594342 CTGAGTAGAAAAGTGGATATGGG + Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1098678710 12:73322674-73322696 CAGAATAGATAAATGAAGAAAGG + Intergenic
1098999439 12:77160843-77160865 ATGAGTTGAAAAATTGACAAAGG - Intergenic
1099688344 12:85918618-85918640 CCCAATTCAAAAATGGACAAAGG - Intergenic
1099794404 12:87380064-87380086 CACAACAGAAAAATGGATAAAGG - Intergenic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1100400864 12:94228023-94228045 CAGATTAGAGAAATGGAAAATGG - Intronic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101185450 12:102271801-102271823 CAATATAGAAAAATGGGCAAAGG - Intergenic
1101293676 12:103398340-103398362 CTGGGTAGAAAAATGAGCAAAGG - Intronic
1101383273 12:104232979-104233001 CTAAATAGGTAAATGCACAATGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102850510 12:116240087-116240109 TAAGATAGAAAAATGGACAAAGG - Intronic
1103099501 12:118160359-118160381 CTGGGTAGAAAAAGTGACAAAGG + Intronic
1103119118 12:118365962-118365984 CAGAATAGAAAATTGGCCATGGG + Intronic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1104047121 12:125171264-125171286 CAAATTAGGAAAATGGACAATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104310302 12:127648822-127648844 ATGAAGAGAAAAATGCACACAGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104359818 12:128122046-128122068 CTGAGTAGTAAAATGGAAAGAGG - Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105906321 13:24813455-24813477 CCAATTACAAAAATGGACAAAGG - Intronic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106645209 13:31626728-31626750 CTAAATAGCAAAATGAATAAAGG - Intergenic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107085983 13:36428699-36428721 CTGAATTGTAATTTGGACAAGGG + Intergenic
1107368205 13:39709471-39709493 CAGAGTAGAATAATAGACAATGG - Intronic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107756743 13:43632079-43632101 CTCAATAGAAAATTGATCAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108007626 13:45967375-45967397 CTCTATAGAAGAATGGAGAATGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108306839 13:49145410-49145432 CTCAAGAGAAAAATGAGCAAAGG - Intronic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108533884 13:51352867-51352889 ATTAATAGAATAAAGGACAAAGG - Intronic
1108556046 13:51593711-51593733 TTCAATGGAGAAATGGACAAAGG - Intronic
1108584013 13:51852312-51852334 CCCAATAGATAAATGGCCAAAGG - Intergenic
1108956105 13:56159352-56159374 GAGAGTAGAATAATGGACAAGGG + Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109004169 13:56848160-56848182 CTGAATTGAAAGATAGACATAGG - Intergenic
1109040160 13:57323896-57323918 CAGAGTAGAAAAATAGACATTGG - Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109224630 13:59677845-59677867 GTGAATGGCAAAATAGACAAAGG + Intronic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109579740 13:64313596-64313618 CAGAATAGAAGAATAAACAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110213145 13:72996215-72996237 CTCAGTAGAAAAATGGGCCAAGG + Intronic
1110303042 13:73951726-73951748 CTGAACAGAATGGTGGACAATGG - Intronic
1110361491 13:74630432-74630454 CTGAAAGGAAAAATGTAGAAAGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1111157430 13:84346799-84346821 TTGAATGGATAAATGTACAATGG - Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1111899588 13:94184458-94184480 CCCATTAAAAAAATGGACAAAGG + Intronic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112509831 13:99998978-99999000 CAGAAAGGAAAAATGGAGAAAGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1113275531 13:108725278-108725300 ATGAACAGAAAAATTGATAATGG - Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114988346 14:28258300-28258322 CTGAAAGGAAAGATGGTCAAAGG - Intergenic
1115019877 14:28664601-28664623 AGAAACAGAAAAATGGACAATGG - Intergenic
1115024015 14:28718650-28718672 CTGACTAGAACAATAGGCAAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115167369 14:30464102-30464124 GTGGATAGAAAAATAGAAAAGGG - Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116163020 14:41293792-41293814 CCCCATTGAAAAATGGACAAAGG + Intergenic
1116382936 14:44295002-44295024 AGGAGTAGAAAAATGGAAAATGG - Intergenic
1116504313 14:45660102-45660124 CCCCATTGAAAAATGGACAAAGG - Intergenic
1116880964 14:50168551-50168573 CTGACTAAAAAAATGAGCAAAGG - Intronic
1116909559 14:50445270-50445292 CTGTATAGAAGAATGAAAAAAGG - Intronic
1117469952 14:56033518-56033540 CAGAATAGAAAAATTGATAATGG + Intergenic
1117861848 14:60100193-60100215 TTCAATAGAAAAATAGGCAAAGG + Intronic
1118204066 14:63705300-63705322 CACAATTGAAAAATGGGCAAAGG + Intronic
1119089527 14:71768052-71768074 TCCAATAGAAAAATGGACAAAGG + Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119552979 14:75529762-75529784 CCCAAAAGAAAAATGAACAATGG + Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120297933 14:82667895-82667917 TTGAAAAGAAAAATGGGGAAAGG - Intergenic
1120324097 14:83003685-83003707 GTAAATCCAAAAATGGACAATGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121847365 14:97184745-97184767 CTGAAGAGAGAAAAGGAAAATGG + Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124827193 15:33109292-33109314 ATTAATAGATAAATGGCCAAAGG + Intronic
1125072553 15:35573359-35573381 CAGAGTAGAAAAATGGACACTGG + Intergenic
1125131864 15:36291243-36291265 CTAAAGAGGAAAATGGACAGTGG + Intergenic
1125140770 15:36404037-36404059 CTGCATGGAAAAAGGGTCAAAGG + Intergenic
1126509803 15:49456704-49456726 CTGAAAAGAAAAAAGGGGAAAGG + Intronic
1127326959 15:57905349-57905371 CTGTTCAGAAAAAGGGACAAAGG + Intergenic
1127332135 15:57949762-57949784 CTACATAGATAAATGGCCAAAGG + Intergenic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1128093731 15:64936900-64936922 CACAAGAGAAAAATGGCCAAAGG + Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129055325 15:72815592-72815614 CTCAATAGAACAATGAGCAAAGG - Intergenic
1129415111 15:75372143-75372165 CTGGGTAGATAAATGGACCAAGG - Exonic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129578015 15:76774234-76774256 CTAAATTGAATTATGGACAAAGG + Intronic
1129685344 15:77683050-77683072 AAGAAAAGAAAAATGGGCAAAGG + Intronic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130634447 15:85604030-85604052 CTCAAAAGAAAAAGGGACACAGG + Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1132471977 16:109873-109895 CCCAATAGAAGAATGAACAAGGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134068155 16:11242978-11243000 CTGAGTAGAGGAATGGAGAAGGG - Intergenic
1134221650 16:12359454-12359476 TGCAGTAGAAAAATGGACAAAGG - Intronic
1134900437 16:17933259-17933281 CTTATTAGAAAAATGAACCAAGG + Intergenic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135243991 16:20838611-20838633 CTGAAAAGAAGTAGGGACAAGGG - Intronic
1135408019 16:22212089-22212111 TTGATTAGCAAAATGCACAAGGG - Intronic
1135475103 16:22767382-22767404 CCCAATAGAAAAATGGTCAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135872844 16:26166931-26166953 TTTGATAGAAAAATGGGCAAAGG - Intergenic
1136391313 16:29966273-29966295 CTTAAAAGAAAAAGGAACAAAGG - Intronic
1136674503 16:31890700-31890722 CTGCATAGTAACATGGCCAAAGG + Intronic
1136948064 16:34679924-34679946 CTGAAAAGAAAATTGAACATAGG + Intergenic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1137842030 16:51649654-51649676 CCGAATAGAAAAAAGGAGAATGG + Intergenic
1138073341 16:54015890-54015912 CAGGATAGAAAAATGGCCAAGGG - Intronic
1138225006 16:55285731-55285753 TTCAATAGAAAAATAGACATGGG + Intergenic
1138291483 16:55851310-55851332 CTCAATTCAAAAATGGGCAAGGG + Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138362980 16:56448566-56448588 CTGAATAGAATAAATGCCAAAGG - Intronic
1139656963 16:68394240-68394262 CTGATTTGGAAAATGGAAAATGG - Intronic
1140008221 16:71101505-71101527 CACAATAGAAAAATGGGCAAAGG + Intronic
1140261237 16:73382426-73382448 CCCAACAGAAAAATGAACAAAGG + Intergenic
1140413607 16:74757172-74757194 ATCAATAGAAAGATGGATAAAGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140659842 16:77178115-77178137 CTGATTTGAAAAGTGGTCAAAGG - Intergenic
1140724115 16:77796939-77796961 CTGAGTAGAATAATAGACACTGG + Intronic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1141783716 16:86183758-86183780 ATAAATAGAAAAATGATCAAAGG + Intergenic
1142175841 16:88644859-88644881 CACAATAGAAAAATGGGCAAAGG + Intronic
1143062917 17:4218041-4218063 CCCAATGGAAAAATGGGCAATGG + Intronic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143105387 17:4527560-4527582 CTCAGTAGAAAAATGGGCACGGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143241753 17:5449352-5449374 CCCAGTAGAAAAATGGACAAAGG + Intronic
1143341877 17:6217729-6217751 CTTAATAGAAAGCTGGGCAAAGG - Intergenic
1143685609 17:8513185-8513207 GGAAATAGAAAAATGGTCAAAGG - Intronic
1143823271 17:9582476-9582498 CTCAATAGAAAAATGAGCAAAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144162521 17:12574796-12574818 CTGAATAGAAAAAATAACTAGGG - Intergenic
1144570416 17:16394548-16394570 CACAATAGGAAAATGGACAAAGG + Intergenic
1144811238 17:18000848-18000870 CCAAATAGAAAAGTGGGCAAGGG - Intronic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1145362565 17:22224310-22224332 CACAATAGGAAAATGGACATAGG + Intergenic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1146191803 17:30774582-30774604 CCCAATAGAAGAATGGGCAAAGG + Intronic
1146295263 17:31645145-31645167 CTGAATAGAACAAATGACAGAGG + Intergenic
1146447748 17:32946027-32946049 CCCAGTAGAAAAATGGGCAAAGG - Intergenic
1146788509 17:35738203-35738225 CCCAATAGAAAAATGGGCAAAGG - Intronic
1146866691 17:36342267-36342289 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147057802 17:37847463-37847485 CTGAACAGAAAAAGGGAGAGAGG + Intergenic
1147069559 17:37942876-37942898 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147081089 17:38022414-38022436 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147097031 17:38146371-38146393 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1147535536 17:41319239-41319261 CCGAGTAGAAAAATTGACAATGG + Intergenic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1148477866 17:47941161-47941183 GGGAAAAGAAAAATGGAAAATGG - Intergenic
1148530575 17:48386688-48386710 TTAATTAGAAAAATGGACACTGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1149805172 17:59610394-59610416 TATAATAGAAAAATGGGCAAAGG + Intergenic
1149889850 17:60378115-60378137 CTCAATTCAAAAATGGGCAAAGG + Intronic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1150949147 17:69782829-69782851 ATGAAAACAAAAATAGACAATGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151347736 17:73513283-73513305 ACCAATAGAAAAATGGGCAAAGG + Intronic
1151533414 17:74722669-74722691 TTCAATAGAAAAGTGAACAAAGG - Intronic
1152655218 17:81516185-81516207 CTGAACAGAAAAAGGAACAGTGG + Intronic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1153154890 18:2137293-2137315 CCCAATAGAAAAGTGGCCAAAGG + Intergenic
1153279035 18:3396758-3396780 CTAAAAAGAAAAAAGGAAAAAGG + Intergenic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153748576 18:8206612-8206634 TTTAATAGAAAAATAGGCAAAGG + Intronic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154227461 18:12519643-12519665 CTCATTAGAAAAATGAACAAAGG + Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155861177 18:30901788-30901810 CTGAATAGAATAATAGATATTGG - Intergenic
1156135171 18:34028986-34029008 CTCAATAGAAGGATGGAAAAAGG - Intronic
1156159645 18:34343945-34343967 CTCAAGAGTTAAATGGACAATGG - Intergenic
1156977926 18:43247585-43247607 CAGAATAGAATAAAGGAAAATGG + Intergenic
1157018533 18:43749906-43749928 TTAGATAGAAAAATGGGCAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158162000 18:54495310-54495332 GCCAATAGAAAAATGGGCAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158260228 18:55598362-55598384 CAAAATAGAAAAAAGGCCAATGG - Intronic
1158276684 18:55776537-55776559 CTCAATAGAAAAACAGGCAAAGG + Intergenic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158343818 18:56494384-56494406 CAGAATAGGAAAATGAACAGAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158555811 18:58473856-58473878 CTGAATAGAAAAAAAAAAAAAGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159899593 18:74033335-74033357 CTTAATAGGAAAATGGGCAAAGG + Intergenic
1160076876 18:75685774-75685796 CAGTGTAGAATAATGGACAATGG - Intergenic
1160077099 18:75688280-75688302 CTTAATACAAAAATTGACAGTGG + Intergenic
1160264983 18:77334631-77334653 CTGAATAGAGCAAAGGCCAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161042821 19:2119071-2119093 CAGAAGAGGAAAAAGGACAACGG + Intronic
1161775165 19:6257497-6257519 CCTAATTCAAAAATGGACAACGG + Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162829146 19:13273468-13273490 CTCAATGGATAAATGGGCAAAGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1163599766 19:18241970-18241992 AAGAAAAGAAAACTGGACAAGGG + Intronic
1164730856 19:30503320-30503342 TCCAATAGAAAAATGGTCAAAGG + Intronic
1164745428 19:30609259-30609281 GTCAATAGAAAAATGGAAACAGG + Intronic
1165967153 19:39592119-39592141 CTGCATAAAAAAGTGGGCAAAGG + Intergenic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
1167527278 19:49992686-49992708 CTTAGTAGGAAAATGGACAAAGG - Intronic
1167580642 19:50339834-50339856 CTCATTAGGAAAATGGACAAAGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1168479727 19:56709561-56709583 CCCAATGAAAAAATGGACAAAGG - Intergenic
1168499682 19:56883127-56883149 ATCAACAGATAAATGGACAATGG - Intergenic
924972147 2:138187-138209 CGAATTAAAAAAATGGACAAGGG - Intergenic
925127769 2:1472977-1472999 AATAGTAGAAAAATGGACAAAGG - Intronic
925955634 2:8961348-8961370 CTTTAAAGAAAATTGGACAATGG + Intronic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927061347 2:19425234-19425256 ATGAAAAGAGAAATGAACAAAGG - Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927228903 2:20800414-20800436 CACAATTGAAAAATGGGCAAGGG + Intronic
927361272 2:22236982-22237004 TTGAATAGAAAGATGGAGATGGG - Intergenic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928040795 2:27875004-27875026 TCCAACAGAAAAATGGACAAAGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
928836528 2:35553874-35553896 CTCAATAGAAAATTGAAAAAAGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929158533 2:38809846-38809868 CCTAATAGAAAAGTGGGCAAAGG - Intronic
929821705 2:45279382-45279404 CCCAAAAGAAAAATGGACAAAGG - Intergenic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
930670163 2:54141119-54141141 CTCGATAGAAAAATGGGTAAAGG - Intronic
931819680 2:65938773-65938795 ATGAATGGAAAAGTGGAGAAGGG + Intergenic
931957377 2:67442549-67442571 TTTGATAGAAAAATGGACAAGGG + Intergenic
932118693 2:69078126-69078148 CTGAATAGTAAACAGGACACTGG + Intronic
932176844 2:69610666-69610688 CCTATTAGAAAAATGAACAATGG + Intronic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932626836 2:73303276-73303298 CTGACTGGAAAAAGGTACAAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933808935 2:86020144-86020166 CCCAATAGAAAAATGGGCAAAGG + Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935012280 2:99146308-99146330 CCCAATAGAAAAATGGGCAAAGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
936591105 2:113805517-113805539 ATCAATAGAAAAATGGACTGAGG + Intergenic
936807220 2:116349548-116349570 ATCAATAGAAAAATGAACACAGG + Intergenic
936895072 2:117418388-117418410 CTCAATAGAAAATTAGAGAAGGG + Intergenic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937544341 2:122998535-122998557 CAAATTAGATAAATGGACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938134813 2:128747835-128747857 TTTAAAAGAAAAATGGGCAAAGG + Intergenic
938180049 2:129173341-129173363 ATAAATAGAAAAATGGGAAAAGG + Intergenic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939107141 2:137962526-137962548 CTAAAGAGAAAAATGGAAGATGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939237567 2:139517009-139517031 TTGAATAGAAGAAAGAACAAAGG + Intergenic
939301896 2:140353562-140353584 CTGTATGGAAAAGTGGGCAAGGG - Intronic
939566238 2:143789523-143789545 CTAGATAGAACAGTGGACAAAGG - Intergenic
939983001 2:148803263-148803285 CCCAATTGAAAAATGGGCAAAGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940614827 2:156037391-156037413 CTGAACAGAAAAATTAATAAAGG + Intergenic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941471709 2:165896533-165896555 CTGAACAGAAAACAGGATAAAGG + Intronic
941530583 2:166665536-166665558 CTAAGTAGAAAAATGGAGCAAGG - Intergenic
941981844 2:171466946-171466968 CCCAATAGAAAAAGGGAAAAAGG - Intronic
942242862 2:173979561-173979583 CTCAATAGAAAATTGGATAAAGG - Intergenic
942657287 2:178227121-178227143 CCCACTAGAAAAATGGACAAAGG + Intronic
942707914 2:178798102-178798124 ATGAATAGAAAAATACACCAGGG - Intronic
942846709 2:180435371-180435393 TTTACTAGAAAAATAGACAAAGG + Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943818216 2:192283348-192283370 CAGAATGGAATAATGGACATTGG + Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
944122451 2:196254903-196254925 CCCAATAGAAAAATGGATAAAGG - Intronic
944335105 2:198523615-198523637 CTGAATTGAAAAATGAAATATGG - Intronic
945231103 2:207591234-207591256 CTGAAAGGAGAAATGAACAAAGG - Intronic
945274308 2:207972785-207972807 CTGCAGAAAAAAATGGACCATGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
946611027 2:221458108-221458130 CTGAAGAGTAAAATGGTCAAGGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946799432 2:223395571-223395593 TTGAATAGAAATGTGAACAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947491583 2:230600325-230600347 CCCAATTGAAAAATGGGCAAAGG + Intergenic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
948028575 2:234798472-234798494 CTGCATAGAAGAATGAAAAAGGG - Intergenic
948473209 2:238199527-238199549 CCCACTAGAAAAATGGTCAAAGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169323218 20:4652634-4652656 CAGAATAGTATAATGGATAATGG - Intergenic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1169838782 20:9910848-9910870 CTCCATAGAAAAGTGGGCAAAGG - Intergenic
1170238718 20:14137954-14137976 CTGAATAGAAAACTTTCCAAAGG + Intronic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170927138 20:20735250-20735272 TCTAATAGAAAAATGGGCAAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172016403 20:31877029-31877051 AAGAAAAGAAAAATGGGCAAAGG - Intronic
1172924259 20:38516673-38516695 CCTAGTAGATAAATGGACAAAGG + Intronic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173466327 20:43284829-43284851 CTTACTAGAAACATGGAAAAGGG + Intergenic
1173497717 20:43531314-43531336 CTGAACAGAGGAAAGGACAAGGG - Intronic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174358526 20:50014102-50014124 CTGTAAAGAGACATGGACAAAGG + Intergenic
1174400040 20:50271047-50271069 CTGAATACAAAAAAGATCAAGGG + Intergenic
1174994855 20:55554849-55554871 CTGAATAGAAAAATGTAATAAGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176898365 21:14410514-14410536 CTCCATTGAAAAATGGGCAAAGG - Intergenic
1177020380 21:15848438-15848460 CTCAAGAGAAAAGTGGAAAAGGG - Intronic
1177256256 21:18666607-18666629 CTTATTAGAAAAATAGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177883853 21:26725023-26725045 CAGAGTGGTAAAATGGACAATGG - Intergenic
1178018731 21:28384073-28384095 CTGAATACAAAAGAGGAGAAGGG - Intergenic
1178135948 21:29627506-29627528 ATGGAGAGAAAAAGGGACAATGG - Intronic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178343409 21:31805110-31805132 CTGGATAGAAAAAGAAACAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178514963 21:33238817-33238839 CTCAACAGAAAAATTGCCAAAGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178862717 21:36302799-36302821 AAGAAAAGAAAAATGGGCAATGG + Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179303184 21:40131222-40131244 CTGATTGGAAGAAGGGACAAAGG - Intronic
1179320001 21:40281814-40281836 CTCAGTAGAAAAATGGGTAAGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180841990 22:18963433-18963455 CCCAAGAGAAAAATGGGCAAAGG - Intergenic
1180910400 22:19446150-19446172 CAGAATGGAAAAATGGCCAAAGG - Intronic
1181059505 22:20275448-20275470 CCCAAGAGAAAAATGGGCAAAGG + Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1184326177 22:43788399-43788421 CCCAATAGAAAAATGGGCTAGGG + Intronic
1184623141 22:45698435-45698457 CCCAATTGAAAACTGGACAAAGG - Intronic
1184714595 22:46273671-46273693 CTCACTAGAAAAATGTTCAAGGG + Intronic
1185363836 22:50425848-50425870 CTCAATTCAAAAATGGTCAAAGG - Intronic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949268846 3:2190884-2190906 CTGTATAGAAAATTGTACTAAGG - Intronic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
950057400 3:10037166-10037188 CCTAATAGAAAAGTAGACAAAGG + Intronic
950157323 3:10731801-10731823 CTCACTAGAAAAATGAGCAAAGG + Intergenic
950356518 3:12414695-12414717 CTGAAAAGAAAAAAAGAAAAAGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951069903 3:18315380-18315402 ATCAATCAAAAAATGGACAAAGG - Intronic
951422370 3:22502588-22502610 AGGAATAGAAAAATGAACAGTGG + Intergenic
951453611 3:22866511-22866533 TTCCTTAGAAAAATGGACAAAGG - Intergenic
951477407 3:23122370-23122392 CCCAGTAGAAGAATGGACAATGG - Intergenic
951766597 3:26206294-26206316 GTGAACAGAAAAATGGAAAGAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951820285 3:26801146-26801168 ATGTATAGAAAAATGTATAAAGG - Intergenic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952163783 3:30723649-30723671 CTGAAGAGAAATATGGCAAATGG + Intergenic
952458662 3:33500548-33500570 AAAAATAGAAAAATGCACAATGG - Intronic
952705633 3:36374933-36374955 CTGAATAAAACAATGACCAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953324488 3:42001424-42001446 CTGCATTGAAAAATGGACTGAGG + Intergenic
953334564 3:42083276-42083298 CCCAAAAGAAAAATGGGCAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953534495 3:43767016-43767038 CTCACTAGAAAAATTGGCAAAGG - Intergenic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
954288034 3:49632933-49632955 CTGAAAAACAAAATGGGCAAAGG + Intronic
954376881 3:50199409-50199431 CTCAATTCAAAAATGGGCAAAGG - Intergenic
954643086 3:52113969-52113991 ATGAAATGAAAAATGCACAAAGG + Intronic
955422851 3:58756822-58756844 CTGAAAAGATAAAAGTACAAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956142714 3:66161900-66161922 TTGAAAAGAAAAATGAACGATGG + Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956464700 3:69507630-69507652 GTGCAAAGAAAAATGTACAAGGG - Intronic
956483196 3:69693722-69693744 GAGAATAGAAAAATGGATATGGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957276882 3:78101704-78101726 CTGAACAGGAAAATGAAAAATGG - Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958102601 3:89034073-89034095 CAGACTGGAAAAATGCACAAAGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958530104 3:95317567-95317589 CTGATTAAAAGAATGGGCAAAGG + Intergenic
958545145 3:95538303-95538325 ATAAATAGAAAAGTGGATAATGG + Intergenic
958559715 3:95730259-95730281 CCCAATTGAAAAATGGGCAAAGG - Intergenic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
959111221 3:102124701-102124723 CTGATTAGAAAATTGAACTATGG - Intronic
959114068 3:102155437-102155459 ATGAACAGAAAAATAGATAAAGG + Intronic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959839486 3:110958212-110958234 CTGAAGTGAAAACTGTACAAAGG - Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
959971237 3:112412430-112412452 CTGTGTAAAAAAATGGGCAAAGG - Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961068861 3:123901834-123901856 CTGATTAGAAAATTGTGCAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961315217 3:126030349-126030371 CTAACTAGAAAAATGCACAAGGG + Intronic
961499901 3:127324778-127324800 CCAAATAGGAAAATGGCCAAAGG + Intergenic
961700012 3:128736318-128736340 CTGAATGATAAAATGTACAAAGG - Intronic
962047884 3:131779998-131780020 CTGCATTAAAAAATGGGCAAAGG + Intronic
962113703 3:132478296-132478318 ATGAATAGGAAAATGAATAATGG + Intronic
962227726 3:133630133-133630155 CCCAGTAGAAAAATGGGCAAAGG - Intronic
962522753 3:136212383-136212405 CAGAAGAGAAAACAGGACAAGGG + Intergenic
962557087 3:136564707-136564729 GTCAAAAGAAAAATGGGCAAAGG + Intronic
963144889 3:141983333-141983355 CTCAATTCAAAAATGGGCAAAGG + Intronic
963242638 3:143023300-143023322 CTGGATACAACACTGGACAAAGG - Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963385631 3:144589332-144589354 ATGAAAAAAAAAATGGAAAAAGG - Intergenic
963401036 3:144800056-144800078 CCCAATAAAAAAATGGCCAAAGG - Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
963727296 3:148936775-148936797 CCCACCAGAAAAATGGACAAAGG - Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
963861969 3:150321291-150321313 CTTCATTGAAAAATGGGCAAAGG - Intergenic
963886097 3:150584757-150584779 CCAAACAGAAAAATGGGCAAAGG - Intronic
964260686 3:154832842-154832864 CTGGATAGGAAAAAGGGCAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
964670199 3:159216616-159216638 CTGAACAGAAAATTAGGCAATGG - Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964731688 3:159873733-159873755 TTAAATAGAAAAAATGACAAAGG - Intronic
964940171 3:162150166-162150188 AACAACAGAAAAATGGACAATGG - Intergenic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965329533 3:167353468-167353490 CAGAGTAGAAAAATAGACACTGG + Intronic
965668682 3:171123499-171123521 CTGAAGAGAAAAAAGAACACAGG + Intronic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
965833319 3:172823107-172823129 ATGAATAGAAAGATGTAAAAAGG + Intergenic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
965924709 3:173963585-173963607 CTGAGAAGAAAAAAGGACAAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
966356654 3:179087081-179087103 CCCAATAGAAAAATAGGCAAAGG + Intergenic
966479870 3:180394948-180394970 ATCAATGGGAAAATGGACAAAGG + Intergenic
966516105 3:180822230-180822252 CCCATTAAAAAAATGGACAAAGG + Intronic
966617149 3:181925751-181925773 CCGAATAGAAAAGTGGGAAATGG - Intergenic
966903187 3:184502118-184502140 CTCAGGAGAAAAATGGACAAAGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
968000573 3:195203250-195203272 CCCAATAGAAAAATGGGCTAAGG + Intronic
968195687 3:196704269-196704291 CCCAATAAAAAAATGAACAAAGG + Intronic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
968993880 4:3933268-3933290 ATGAGTAGCAAAATGGACATTGG + Intergenic
969324673 4:6434903-6434925 TTCAATAGAAGAATGGATAAAGG - Intronic
969548678 4:7849378-7849400 CAGCATAGAAAAATCAACAAAGG + Intronic
970258817 4:14201136-14201158 GAGAATAGAAAAATGACCAATGG - Intergenic
970303288 4:14703757-14703779 CTAAATAGAACCATGGACATGGG - Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
971212745 4:24635472-24635494 CCCAGTAGAAATATGGACAAAGG + Intergenic
971267430 4:25107796-25107818 CAGAAAAGAATAATGGAAAATGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971417806 4:26449585-26449607 CAGAGTGGAAAAATGGACATTGG + Intergenic
971857930 4:32066797-32066819 CTCAAAAGAAAAATGTGCAAAGG + Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972720748 4:41695053-41695075 CCAAATAGAAGAATGGGCAAAGG - Intronic
973017162 4:45154791-45154813 ATGAATGGAAATATGGACAGAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973881553 4:55277793-55277815 CCCAATTGAAAAATGGGCAAAGG - Intergenic
974052340 4:56952619-56952641 CAAGAAAGAAAAATGGACAAGGG - Intergenic
974096022 4:57365191-57365213 CACAATAGAAAAAAGAACAAAGG + Intergenic
975454522 4:74574685-74574707 ATAAATAGAAAAATTGGCAAAGG - Intergenic
975521300 4:75303781-75303803 CTCAATGGAAAAATGGGTAAAGG - Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976256408 4:83105146-83105168 CTGAATAGAAACATTGAAGATGG - Intronic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
977859320 4:101937408-101937430 CTCCATCGAAAAGTGGACAAAGG + Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
977997060 4:103507406-103507428 CTGAAAAGAAAAATGAGCACAGG + Intergenic
978030471 4:103936152-103936174 CTCACTAAAAAAATGGGCAAAGG + Intergenic
978708260 4:111743818-111743840 CTCAATGGAAAAGTGTACAATGG + Intergenic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
979880807 4:125957177-125957199 CTGAATAAAAAAGAGGACCATGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
980757546 4:137185465-137185487 CCGATGAAAAAAATGGACAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981243262 4:142504201-142504223 CTCAATAGAAATAGGGGCAAAGG + Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981252238 4:142617168-142617190 CTGAATAGAATAAATGATAATGG - Intronic
981254088 4:142640738-142640760 CATAATAGAAAAAAGGTCAAGGG + Intronic
981289671 4:143059659-143059681 CTCTATAGAAAAGTGGGCAAAGG - Intergenic
981305537 4:143243318-143243340 CCCAATAGAAAAATGGGCAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981350506 4:143723923-143723945 TCCAATAGAAAAATGGGCAAAGG + Intergenic
981572474 4:146167343-146167365 CTTTATTGAAAAATGGGCAAAGG - Intergenic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982273680 4:153617914-153617936 TTCAAAAGAAAAATGGGCAAAGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985207291 4:187552471-187552493 TTTAATAGAAAATTGGAAAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986180454 5:5388436-5388458 CCCAAAAGGAAAATGGACAAAGG + Intergenic
986211577 5:5678481-5678503 GTGAAGAGAGAAATGGACACAGG + Intergenic
986578683 5:9240319-9240341 CTGAATAGAGAACAGGATAAAGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986973863 5:13372347-13372369 CCCAATAGAAAAATGGGAAAAGG + Intergenic
987105911 5:14639090-14639112 TTGAAAAAAAAAATGGGCAAAGG - Intergenic
987254313 5:16133956-16133978 CTGCACAGAAAATTGGCCAAAGG + Intronic
987830384 5:23087729-23087751 CTTCATAGAATAATGGAAAATGG + Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
987944145 5:24582698-24582720 GTCAATAGAAAGATTGACAAAGG + Intronic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988818791 5:34860637-34860659 CTAAAGAGAAAAATGGACTCTGG - Intronic
988950197 5:36248703-36248725 CTGAATTGAAAAATGAAATAGGG + Intronic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989632502 5:43500278-43500300 CCTAATAGAAAAATGGGCAAAGG - Intronic
989741380 5:44776996-44777018 GTTATTAGAAAAATGCACAATGG - Intergenic
989997861 5:50857043-50857065 CTTAATAGATAAATGGAAACAGG - Intergenic
990020328 5:51118666-51118688 CTGAAGAGAAAAGGGAACAAGGG + Intergenic
990180952 5:53160054-53160076 CTCAATTCAAAAATGGGCAAAGG + Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990423562 5:55661851-55661873 CCCGATAGAAAAATGGGCAAAGG + Intronic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990550415 5:56871036-56871058 ATAAATAGTACAATGGACAAAGG - Intronic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990745181 5:58951587-58951609 CTAAGAAGAAAAATGGGCAAAGG + Intergenic
990962325 5:61407652-61407674 ACAAATAGAAAAATGGGCAAAGG + Intronic
991250481 5:64555084-64555106 CAGAACAGGAAAATAGACAATGG + Intronic
991375315 5:65959317-65959339 CTCCATAGAAAAATGAAAAAAGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
992052568 5:72955322-72955344 CTGAAGAGAACTATGGACTATGG + Intergenic
992065825 5:73107092-73107114 CTGATTCAAAAAATGGGCAATGG - Intergenic
992252412 5:74888532-74888554 CCCAATAGAAAAATGGGCAAAGG - Intergenic
992307593 5:75459323-75459345 CTGAAGATAAGAATGTACAAAGG + Intronic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
992523166 5:77577329-77577351 AAGAAAAGAAAAATGGGCAAAGG + Intronic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993147437 5:84113172-84113194 CTGAATACAAAAATAGAATACGG + Intronic
993172243 5:84433686-84433708 CTGATTAGGAAACTGGACAATGG + Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
993746579 5:91605598-91605620 CTAAATAGAAAAAAGGGAAAAGG - Intergenic
994059091 5:95454152-95454174 CTGATAAAAAAAATGGGCAAAGG + Intergenic
994100658 5:95888594-95888616 CTGATTTGAAATATAGACAATGG + Exonic
994275719 5:97834629-97834651 GTAAATAGAAAAATGCAGAAAGG + Intergenic
995146379 5:108791454-108791476 ACGAACAAAAAAATGGACAAAGG - Intronic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995261143 5:110105932-110105954 CTGCATTGAGAAATGGACCACGG - Intergenic
995354489 5:111223336-111223358 CTGAAAAGAAAAAAGTTCAAGGG + Intergenic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
995816203 5:116171146-116171168 CTGCATCAAAAAATGGGCAAAGG + Intronic
995984636 5:118154847-118154869 ATGAAGAGAAGAATAGACAAAGG - Intergenic
996117826 5:119637580-119637602 TTTAAAAAAAAAATGGACAAGGG - Intergenic
996166166 5:120226553-120226575 TTAAATTGAAAAATGTACAATGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996517523 5:124388864-124388886 CCTAATTCAAAAATGGACAAAGG + Intergenic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996978132 5:129459714-129459736 CTGACCAGAAAAAGGGACCAAGG - Intergenic
997090568 5:130851669-130851691 CTCAATAGAAATATGGGCAAAGG - Intergenic
997706405 5:135957755-135957777 ATTGATAGAAAAATGGGCAAAGG + Intergenic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998544824 5:143018166-143018188 TGAAATAGAAAAATGGGCAAAGG - Intronic
998979210 5:147682240-147682262 GTGAATAGAAAAATGGCAAGAGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999424273 5:151473492-151473514 CTGAAGAGAAAAACATACAAAGG + Intronic
999634506 5:153606938-153606960 CTGAATACCAAATTGAACAAGGG - Intronic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
999885607 5:155919712-155919734 CTGAAAAGAAAATAGGAAAAGGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000244635 5:159439228-159439250 ATAAATAGAAAAATAGCCAAGGG + Intergenic
1000588507 5:163129519-163129541 CGGAAGGGAAAAATGGACAGAGG + Intergenic
1000667860 5:164021046-164021068 CTGAATAGAGGATTGAACAAAGG + Intergenic
1000795429 5:165658653-165658675 TTGAAGAGAAAAAAGGAAAAGGG - Intergenic
1000813979 5:165898022-165898044 CATAAAAGATAAATGGACAAAGG - Intergenic
1001090154 5:168734002-168734024 CCGAGTAGAATAATGGACACTGG + Intronic
1001531770 5:172467432-172467454 CCTAATTCAAAAATGGACAAAGG - Intergenic
1002219234 5:177665960-177665982 CGCAACAGAAAAATGGGCAAAGG + Intergenic
1002325398 5:178401813-178401835 CTCAAAAGAAAAAAAGACAAAGG - Intronic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003381960 6:5632806-5632828 CTCAATTGAAAAGTGGGCAAAGG - Intronic
1003519825 6:6848785-6848807 CTCAACAGAAAAATGCTCAAAGG - Intergenic
1003541273 6:7020110-7020132 CTCAATTGAAAAATGAACTAAGG + Intergenic
1003846358 6:10178170-10178192 ATGGATAGAAACATGGTCAATGG + Intronic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004108652 6:12691588-12691610 CTCAATAGAAGAATTGGCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004526603 6:16414792-16414814 TTGAGTAGAAAGAAGGACAAAGG - Intronic
1004792312 6:19040385-19040407 GTGAAGAGAAGAATGGAGAAGGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005907166 6:30273356-30273378 CCTAATTCAAAAATGGACAAAGG + Intergenic
1006527240 6:34617238-34617260 CTTAATAGAAGAATGAACTAAGG + Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1007068073 6:39013548-39013570 GTGATTAGAAAAAGGCACAAAGG + Intronic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009028229 6:58025345-58025367 CTGAATAGAAAAATCTACTTTGG + Intergenic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009055500 6:58329791-58329813 CTGAAGGGAAAAAAGGAAAAAGG + Intergenic
1009203762 6:60776730-60776752 CTGAATAGAAAAATCTACTTTGG + Intergenic
1009235666 6:61120784-61120806 CTGAAGGGAAAAAAGGAAAAAGG - Intergenic
1010103333 6:72137518-72137540 CTCAATAGAAAAATAAGCAAAGG - Intronic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010417071 6:75624688-75624710 CCAGATAGAAAAATGGGCAAAGG - Intronic
1010543179 6:77117562-77117584 CTTAATTGAACAATGGAGAAAGG + Intergenic
1010624602 6:78122079-78122101 AAGATTAGAACAATGGACAATGG + Intergenic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011126432 6:84012755-84012777 AGGTATAGAAAAATGGGCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011520956 6:88205531-88205553 ATCAACAGAAAAATGAACAAAGG + Intergenic
1011595807 6:89014720-89014742 CTCATTAAAAAAGTGGACAAAGG - Intergenic
1011749917 6:90445013-90445035 CAGAATAGAAAGAGAGACAAAGG + Intergenic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012128424 6:95459332-95459354 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1012384392 6:98661911-98661933 TCCAACAGAAAAATGGACAAAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012544276 6:100399115-100399137 CTCAATTCAAAAATGGGCAAAGG - Intronic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013147873 6:107412539-107412561 CATTATAGAAAAATGGGCAAAGG - Intronic
1013251045 6:108333644-108333666 CCCAGTAGAAAAATAGACAAAGG + Intronic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013554176 6:111239700-111239722 CCGAACAGAAAAATAAACAAAGG - Intergenic
1013731859 6:113177488-113177510 CAGAATAGTATAATGGACATTGG - Intergenic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014228679 6:118877369-118877391 CCTAATGGAAAAATGGAGAATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015025522 6:128527750-128527772 CTTATTTGAAAAATGGAGAAGGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015433473 6:133157602-133157624 CTGGCTAGAAAAATGGTTAATGG + Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1015877349 6:137836242-137836264 TTGAATGGAAACATGGAAAAAGG - Intergenic
1016006135 6:139091112-139091134 CTCAATAGAAACATGGCTAAGGG + Intergenic
1016106258 6:140166715-140166737 CCCAATTCAAAAATGGACAAAGG - Intergenic
1016192066 6:141281517-141281539 CTAAAAAGAAAACTGAACAAAGG + Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016635081 6:146279071-146279093 CACAATAGAAAAATGGACTCAGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016941894 6:149489262-149489284 CAGAATAGGAAAATGGGCAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018269742 6:162064267-162064289 CTGACTAGAAAAAGAGATAAGGG + Intronic
1019773353 7:2897358-2897380 CTGAGTATAAAAATGGTCACTGG + Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020644865 7:10802468-10802490 AGAAATAGAAAAATAGACAAGGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020853159 7:13382905-13382927 CTGTACAGCAAAATGGACCACGG - Intergenic
1020960084 7:14791454-14791476 TTGAATTGAAAAAGGGATAATGG + Intronic
1021035882 7:15797621-15797643 CTGAAGAGAAAAATTGAAAAAGG - Intergenic
1021066837 7:16185789-16185811 CTGATTGGAAAAGTGAACAAGGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021596387 7:22321687-22321709 CAGAATAGGAAAAGGGACAGTGG - Intronic
1021606841 7:22416650-22416672 CTCAATAAAAAAATGGGTAAAGG + Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1022056366 7:26739468-26739490 CTGAAATGAATAATAGACAATGG + Intronic
1022202974 7:28136007-28136029 CTGAAGTGAAACATGGAGAATGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022872705 7:34495999-34496021 CTGATTAGAAAAGTGGACAGGGG - Intergenic
1023073917 7:36464243-36464265 GACAATTGAAAAATGGACAAAGG - Intergenic
1023112589 7:36828781-36828803 CTGAATGGAAATAAGAACAAAGG - Intergenic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023677685 7:42647621-42647643 ATGATTAGGAAAATGGACATTGG + Intergenic
1023763858 7:43492435-43492457 CTGAATAGAATAAGGAAGAAAGG - Intronic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024742224 7:52366836-52366858 CCCAGTAGAAAAATGGACATGGG + Intergenic
1024838864 7:53560043-53560065 CTTAATAGAAAAAGGAAAAAAGG - Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027146402 7:75698180-75698202 ATGAATAGAAAATAGGAAAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027793764 7:82665873-82665895 TTGAAAAGAAAAATGAACTATGG - Intergenic
1027812448 7:82921899-82921921 CTTATTAAAAAAATGGTCAAAGG + Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028138931 7:87250765-87250787 GTCAATAGCAAAATGGGCAAAGG - Intergenic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028156587 7:87436654-87436676 CTAAAGAGAACAATGGACTAGGG + Intronic
1028303978 7:89238636-89238658 CTGAACAGAAATATTGCCAAGGG + Intronic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028509416 7:91607329-91607351 CTCTGTAGAAAAATGGACTAAGG - Intergenic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028628250 7:92902513-92902535 GTTGATAGAAAAATGGGCAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028929955 7:96401914-96401936 CAGAATAGAAAAGTGGAGGATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1029683153 7:102126482-102126504 CTGTATAGAAAAAAAGACTATGG - Intronic
1030364843 7:108633839-108633861 CCCAATTGAAAAATGGGCAAAGG - Intergenic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1030995819 7:116357236-116357258 CAGAATAGGACAATGGACAGTGG + Intronic
1031106781 7:117553743-117553765 CTCATTAGGAAAATGTACAAAGG + Intronic
1031395467 7:121268491-121268513 AAGAATAGAAAAAAGGAAAAGGG + Intronic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1031586527 7:123537092-123537114 ATGAAAAGGAAAATGGAAAATGG - Exonic
1032241849 7:130167490-130167512 TTTATTAGAAAAATGGACAAAGG - Intronic
1032367042 7:131309032-131309054 CCTTATAGAAAACTGGACAATGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032766926 7:135002885-135002907 ATCAATAGCAAAATGGGCAAAGG - Intronic
1033281033 7:140006527-140006549 CTAGCTAGAAAAATGGTCAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033571616 7:142634684-142634706 CCAAAAAGAAATATGGACAAAGG + Intergenic
1033734748 7:144210641-144210663 CTCAACAGAAAAGTAGACAAAGG - Intergenic
1033748307 7:144340328-144340350 CTCAACAGAAAAGTAGACAAAGG + Intergenic
1033766871 7:144503119-144503141 ATGAAGAGAAAAATGGATATTGG - Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034173818 7:149084626-149084648 CTGCATTAAAAAATGGGCAAAGG - Intronic
1034591366 7:152142307-152142329 AAAAATTGAAAAATGGACAAAGG + Intronic
1034645512 7:152642962-152642984 ATAAGTAGAAAAATGGGCAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035079368 7:156203399-156203421 TTGAATAGTAAAACAGACAATGG - Intergenic
1035192042 7:157178435-157178457 CAGACAAGAAAAATGGACAGTGG - Intronic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1036598633 8:10239056-10239078 CCCAATAGAAAAATGAACAGAGG + Intronic
1037162051 8:15785453-15785475 CTGAATAGAAAAAAAAAAAAAGG - Intergenic
1037782921 8:21883211-21883233 CCCAATTCAAAAATGGACAAAGG + Intergenic
1037919406 8:22794138-22794160 CTAAGTAGAAAAATGAGCAAAGG - Intronic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039012696 8:33112022-33112044 CTGGAAAGGAAAATGGCCAAAGG + Intergenic
1039089395 8:33812430-33812452 CTGAAAAGAAATATAGAAAAGGG - Intergenic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039626098 8:39055434-39055456 CCCAACAGAAAAATGAACAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039908169 8:41801686-41801708 CATAACAGAAAAATGGGCAAAGG - Intronic
1040056344 8:43060920-43060942 TTTAATCAAAAAATGGACAAAGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040836787 8:51740627-51740649 GTGAATAGAAAAATTCTCAAAGG - Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1040994037 8:53383242-53383264 CTCAATCAAAAAATGGGCAAAGG + Intergenic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041435416 8:57834562-57834584 CAGAATAGAAAAATCTACAAAGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041448544 8:57981565-57981587 CTTATTAGTAAAATTGACAAGGG - Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042074262 8:64972441-64972463 CCCAATGAAAAAATGGACAAAGG - Intergenic
1042474925 8:69236804-69236826 TTCAAAAGAAAAATGGGCAATGG - Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042784501 8:72533348-72533370 CAGAATGGAATAATGGACATTGG - Intergenic
1042809187 8:72805321-72805343 CTGATTAGAACCATGGCCAAAGG - Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043607497 8:82020065-82020087 ATGAAAAGAAATATGGACAGTGG - Intergenic
1043953917 8:86340175-86340197 CTCAGTAAGAAAATGGACAAAGG + Intergenic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044578149 8:93793684-93793706 CATAATAGAGAAATGGGCAAGGG - Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044678766 8:94755882-94755904 CTCAAAAAAAAAAAGGACAATGG + Intronic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045065546 8:98440525-98440547 TTGAATAGAAAACTGAACCAGGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045233913 8:100332813-100332835 CCTAATAGGAAAATGGGCAAAGG - Intronic
1045291629 8:100838100-100838122 CCCAATAGAAAAATGAGCAAAGG + Intergenic
1045714973 8:105032103-105032125 CCTACTAGAAAAATGAACAAAGG - Intronic
1045802917 8:106122770-106122792 CTGAGTGGAAAAATTGATAATGG + Intergenic
1046558777 8:115811896-115811918 CTGATTAAAAAAATGAAAAAAGG + Intergenic
1046762588 8:118036805-118036827 CTCAAAAGAACAATGGAGAAAGG - Intronic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1047039798 8:120980272-120980294 CTCAATTGAAAAATGAAAAAAGG + Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049044111 8:140136149-140136171 CTTAAAAAAAAAATAGACAAGGG + Intronic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049976367 9:863868-863890 ATCAATAGAGAAATGGGCAAAGG - Intronic
1050392812 9:5164462-5164484 GTTAATACAAAAATGTACAAAGG - Intronic
1050476471 9:6046087-6046109 CTGAATAGAAGAGTCTACAAGGG + Intergenic
1050682533 9:8129796-8129818 CTGAATGGAATAATAGATAACGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051178687 9:14387534-14387556 CTCAATGGAAAAATGAGCAAAGG + Intronic
1051324622 9:15951689-15951711 CTGATTTAAAAAATGGGCAAAGG - Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051530502 9:18097066-18097088 CTGACTAGGAAGGTGGACAAGGG - Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1051875818 9:21792130-21792152 CTGATTTAAAAAATGGGCAAAGG + Intergenic
1051879538 9:21825963-21825985 CTGATTAAAAAAATAGGCAAAGG - Intronic
1052322030 9:27177789-27177811 CCTGATAAAAAAATGGACAAAGG - Intronic
1052333541 9:27296449-27296471 CCTAATGGAAAAATGGGCAAGGG + Intronic
1052711462 9:32061656-32061678 CAGAATAGTATAATGGACATTGG - Intergenic
1052713422 9:32086186-32086208 CTTAATTGAAAAATGCACAAAGG + Intergenic
1052884144 9:33626920-33626942 CCAAAAAGAAATATGGACAAAGG + Intergenic
1053195362 9:36113800-36113822 CCTAATAGAAAAATGGACCAAGG + Intronic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053612277 9:39726788-39726810 ACGAATACAAAACTGGACAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053870311 9:42484781-42484803 ACGAATACAAAACTGGACAAAGG + Intergenic
1054085978 9:60744367-60744389 ACGAATACAAAACTGGACAAAGG - Intergenic
1054241240 9:62615604-62615626 ACGAATACAAAACTGGACAAAGG - Intergenic
1054555369 9:66650128-66650150 ACGAATACAAAACTGGACAAAGG - Intergenic
1055029995 9:71764436-71764458 CTGACTGGAAACAGGGACAAAGG + Intronic
1055385576 9:75758585-75758607 CCTAATACAAAAATGGGCAAAGG - Intergenic
1055673493 9:78631303-78631325 GAGAATAGAAAAAAGAACAAGGG + Intergenic
1056483716 9:87032964-87032986 CTGGTTAGAAAAATGGAAATAGG + Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057187926 9:93068037-93068059 CAAAATTGAAAAATGGCCAAAGG - Intronic
1057577877 9:96258045-96258067 CTCCATAGAAGAATGGGCAAGGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057760046 9:97864738-97864760 CTTAATTCAAAAATGGGCAAAGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058319637 9:103612851-103612873 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059533866 9:115063083-115063105 CTGAATAGTAAACTGGTCATAGG + Exonic
1059607968 9:115856842-115856864 CTGACTAGGAAGATGGACATTGG + Intergenic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061049755 9:128187669-128187691 CCTAAAAGAAAAATGAACAAAGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1185495432 X:550768-550790 ATGAATAGAAGAATGAAAAATGG - Intergenic
1185802515 X:3026718-3026740 GTGAGTAGAAAAATGGCCAGAGG - Intronic
1186604479 X:11076286-11076308 CTGAAGAGAAAAGTGCAGAACGG + Intergenic
1186902320 X:14070090-14070112 CTGAATACAAAAATAAGCAAAGG + Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187692737 X:21887264-21887286 CACAATAGAAAACTGGGCAAAGG - Intergenic
1187819015 X:23265344-23265366 TGGAACAGAAAAATGGGCAAAGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188919473 X:35954781-35954803 ATAATTAGAATAATGGACAATGG - Intronic
1189072754 X:37882332-37882354 CAGAATAGAAAAATCTAGAAAGG + Intronic
1189242616 X:39537373-39537395 TAGAACAGAAAAATGGAGAAAGG + Intergenic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189679402 X:43499640-43499662 TCCAATAGAAAAATGGGCAAAGG - Intergenic
1189699718 X:43705776-43705798 CCCAATTCAAAAATGGACAAAGG + Intronic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189761523 X:44326521-44326543 CCCAACAGAAAAATGGGCAATGG + Intronic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190141647 X:47851566-47851588 CCTAATAGAAAAATGGGAAAAGG - Intronic
1190390843 X:49930049-49930071 TTTACTAGAAAAATGTACAAAGG + Intronic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190871186 X:54426013-54426035 CCCAATAGAAAAATGGCCAAGGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191030858 X:55969047-55969069 CTAGATAGAAAAATTAACAAAGG + Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192197575 X:69038941-69038963 CCCAATAGAAAAATGTGCAAAGG - Intergenic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1192478229 X:71462212-71462234 CCCAAAAGAAAAATGGGCAAAGG + Intronic
1192607378 X:72532692-72532714 CTCAATTGAAAAATGTATAAAGG - Intronic
1192746857 X:73947823-73947845 CTTAAAAGAAAAAAGGAAAATGG + Intergenic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193498770 X:82245873-82245895 CTCAACAGAAAAATGGGTAAAGG - Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193767781 X:85551933-85551955 CTAATTTCAAAAATGGACAAAGG - Intergenic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1193860346 X:86658109-86658131 GTGAAGAGCAAAATGCACAATGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194011133 X:88563272-88563294 TGGAATAGAAAAATAGACACTGG + Intergenic
1194678536 X:96822888-96822910 CCTAATAGAAATATGAACAAAGG + Intronic
1194682461 X:96870641-96870663 ATCAATAGTAAAATGGCCAAAGG - Intronic
1194882917 X:99275503-99275525 CTTAATAGAAAAATTGATCAAGG + Intergenic
1194885920 X:99316101-99316123 AAAAATAGAAAAATGGAAAAAGG - Intergenic
1194988854 X:100522653-100522675 CCCAATAGAAAAATCGACATGGG - Intergenic
1195012836 X:100750308-100750330 CTGATTAAAAAAATGGGTAAAGG - Intergenic
1195092953 X:101480712-101480734 CTGAATAGGAAAATACTCAAAGG + Intronic
1195271816 X:103239313-103239335 CTAAAGAGTAAAATGGACAAGGG - Intergenic
1195283334 X:103358069-103358091 ATAAGTAGAAATATGGACAAAGG - Exonic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1196779172 X:119367151-119367173 TTGAATAGAAAAATAAACCATGG - Intergenic
1197204246 X:123776162-123776184 CGCATTAGAAAAATAGACAAAGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197490696 X:127113393-127113415 CTCAACAGTAAAATGGACACAGG - Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1197900093 X:131361893-131361915 ATGAATAGAAAAATGAGTAAAGG - Intronic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198668218 X:139047879-139047901 CCTAATAGATAAATGAACAAAGG - Intronic
1199145495 X:144361234-144361256 CAGAAAGGAAAAAAGGACAATGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199734049 X:150667573-150667595 TTTAAGAGAAAAATGGGCAAAGG + Intronic
1199800078 X:151241718-151241740 CTCAATAGAAATGTGGACAAAGG + Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200291891 X:154883428-154883450 CCGAATTAAAAAATGGGCAAAGG + Intronic
1200338729 X:155379165-155379187 CCGAATTAAAAAATGGGCAAAGG + Intergenic
1200347740 X:155461527-155461549 CCGAATTAAAAAATGGGCAAAGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201758146 Y:17512364-17512386 TCAAATTGAAAAATGGACAAGGG - Intergenic
1201843409 Y:18393626-18393648 TCAAATTGAAAAATGGACAAGGG + Intergenic
1201920707 Y:19230643-19230665 TTGAAAAGAAAAAAAGACAAGGG - Intergenic
1202251244 Y:22875713-22875735 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202404232 Y:24509462-24509484 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202466547 Y:25160620-25160642 CTGAATCAAAAAGTGGGCAAAGG - Intergenic