ID: 1171755414

View in Genome Browser
Species Human (GRCh38)
Location 20:29103680-29103702
Sequence ACATGGCATCTGTACAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171755411_1171755414 1 Left 1171755411 20:29103656-29103678 CCTTCTGTCACCAAATCTGAAGT No data
Right 1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG No data
1171755413_1171755414 -9 Left 1171755413 20:29103666-29103688 CCAAATCTGAAGTTACATGGCAT No data
Right 1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG No data
1171755410_1171755414 11 Left 1171755410 20:29103646-29103668 CCTTTAAATTCCTTCTGTCACCA No data
Right 1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG No data
1171755409_1171755414 26 Left 1171755409 20:29103631-29103653 CCTATCTAGTTCTAGCCTTTAAA No data
Right 1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG No data
1171755408_1171755414 27 Left 1171755408 20:29103630-29103652 CCCTATCTAGTTCTAGCCTTTAA No data
Right 1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171755414 Original CRISPR ACATGGCATCTGTACAAGCT AGG Intergenic
No off target data available for this crispr