ID: 1171756299

View in Genome Browser
Species Human (GRCh38)
Location 20:29113199-29113221
Sequence AAGTCCTTCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171756297_1171756299 2 Left 1171756297 20:29113174-29113196 CCATGGAAAAATTACCTGTCAAA No data
Right 1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG No data
1171756296_1171756299 18 Left 1171756296 20:29113158-29113180 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171756299 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr