ID: 1171770073

View in Genome Browser
Species Human (GRCh38)
Location 20:29315986-29316008
Sequence TGAGTATGCTTGTAGGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171770073_1171770076 -10 Left 1171770073 20:29315986-29316008 CCAATAACCTACAAGCATACTCA No data
Right 1171770076 20:29315999-29316021 AGCATACTCAGAGATAGTGTGGG No data
1171770073_1171770077 -5 Left 1171770073 20:29315986-29316008 CCAATAACCTACAAGCATACTCA No data
Right 1171770077 20:29316004-29316026 ACTCAGAGATAGTGTGGGTTTGG No data
1171770073_1171770078 16 Left 1171770073 20:29315986-29316008 CCAATAACCTACAAGCATACTCA No data
Right 1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171770073 Original CRISPR TGAGTATGCTTGTAGGTTAT TGG (reversed) Intergenic
No off target data available for this crispr