ID: 1171770074

View in Genome Browser
Species Human (GRCh38)
Location 20:29315993-29316015
Sequence CTATCTCTGAGTATGCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171770074_1171770078 9 Left 1171770074 20:29315993-29316015 CCTACAAGCATACTCAGAGATAG No data
Right 1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171770074 Original CRISPR CTATCTCTGAGTATGCTTGT AGG (reversed) Intergenic
No off target data available for this crispr