ID: 1171770078

View in Genome Browser
Species Human (GRCh38)
Location 20:29316025-29316047
Sequence GGTTCCAGACAACCACAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171770073_1171770078 16 Left 1171770073 20:29315986-29316008 CCAATAACCTACAAGCATACTCA No data
Right 1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG No data
1171770074_1171770078 9 Left 1171770074 20:29315993-29316015 CCTACAAGCATACTCAGAGATAG No data
Right 1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171770078 Original CRISPR GGTTCCAGACAACCACAATA AGG Intergenic
No off target data available for this crispr