ID: 1171770389

View in Genome Browser
Species Human (GRCh38)
Location 20:29318928-29318950
Sequence CGCTCACGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171770389_1171770395 16 Left 1171770389 20:29318928-29318950 CCCACAGGGGGCTTTCGTGAGCG No data
Right 1171770395 20:29318967-29318989 TCCTCCGCTCCAGCCTAGCCAGG No data
1171770389_1171770399 25 Left 1171770389 20:29318928-29318950 CCCACAGGGGGCTTTCGTGAGCG No data
Right 1171770399 20:29318976-29318998 CCAGCCTAGCCAGGCTGCGCAGG No data
1171770389_1171770401 29 Left 1171770389 20:29318928-29318950 CCCACAGGGGGCTTTCGTGAGCG No data
Right 1171770401 20:29318980-29319002 CCTAGCCAGGCTGCGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171770389 Original CRISPR CGCTCACGAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr