ID: 1171770395

View in Genome Browser
Species Human (GRCh38)
Location 20:29318967-29318989
Sequence TCCTCCGCTCCAGCCTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171770390_1171770395 15 Left 1171770390 20:29318929-29318951 CCACAGGGGGCTTTCGTGAGCGA No data
Right 1171770395 20:29318967-29318989 TCCTCCGCTCCAGCCTAGCCAGG No data
1171770389_1171770395 16 Left 1171770389 20:29318928-29318950 CCCACAGGGGGCTTTCGTGAGCG No data
Right 1171770395 20:29318967-29318989 TCCTCCGCTCCAGCCTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171770395 Original CRISPR TCCTCCGCTCCAGCCTAGCC AGG Intergenic
No off target data available for this crispr